Пироплазмоз у кошек курсовая работа: Курсовая работа по теме «Пироплазмоз собак» (скачать)

Автор: | 06.04.1983

Содержание

Пироплазмоз у кошек

Возбудителем заболевания являются внутриклеточные паразиты. Переносчиками чаще всего являются клещи. В ранку, которая формируется за счет укуса клеща, бабезии – паразиты, проникают в кровяные клетки. Именно они и вызывают весьма опасное заболевание, как пироплазмоз.

Пироплазмоз у кошек – достаточно редкое заболевание, и за последние годы зарегистрировано весьма незначительное количество случаев. Симферополь – не исключение. Тем не менее, если вы обратили внимание на подобную симптоматику, вам непременно нужно обратиться к специалистам. В данном вопросе, вам поможет ветеринарная клиника АВВА, специалисты которой смогут правильно диагностировать заболевание и назначить высокоэффективное лечение.

Симптомы

  1. Значительная апатия;
  2. Сниженный аппетит, бывают даже ситуации, когда кошки отказываются от приема пищи;
  3. Температура тела повышается;
  4. Формируется изменение цвета мочи, моча может быть черного, бурого и красного цвета;
  5. Слизистые приобретают желтоватые или же бледные оттенки;
  6. Достаточно часто наблюдается сбой в работе ЖКТ.

Болезнь развивается достаточно интенсивно, в тяжелых случаях возможно даже гибель животного, причем она может произойти в течение нескольких суток, после первоначального проявления симптомов заболевания. В кратчайшие сроки при обнаружении подобных симптомов нужно будет обратиться в ветеринарную клинику и сдать анализы, что сможет стать основой назначения грамотного лечения.

Причины возникновения

Переносчиками заболевания являются клещи. После укуса формируется ранка, в которую и проникает возбудитель. Также заболевание может быть передано животному от другого животного при возникновении повреждений тканей, при переливании крови.

Лечение

Процесс лечения базируется на двух основных направлениях:

  • Уничтожение бабезий – возбудителя заболевания;
  • Снятие интоксикации у животного.

Формируется необходимость индивидуальной проработки метода лечения, в зависимости от сложности течения заболевания и от симптоматики. Применяются токсические препараты, которые могут негативно сказаться на общем состоянии животного, именно по этой причине применяется дополнительное включение препаратов, которые направлены на снижение уровня токсинов в организме, и направлены на общее повышение иммунитета животного.

Профилактика

Владельцам кошек нужно понимать, что процесс распространения заболевания основан на укусах клеща. Поэтому, в период с мая и до ноября следует использовать определенные средства защиты от клещей. Это могут быть специализированные спреи, капли или же ошейники. При возникновении подозрений на заболевание, нужно оперативно обратиться к ветеринарному врачу, так как на начальной стадии болезни лечение является наиболее эффективным и качественным, без негативных побочных явлений.

Курсовая работа

ФГОУ ВПО “Санкт-Петербургская Государственная Академия Ветеринарной Медицины”

Кафедра паразитологии им. В.Л. Якимова

Пироплазмоз собак

Выполнил:

Проверил:

Оценка:________

Санкт-Петербург

2008

Содержание

  1. Введение

  2. История открытия пироплазмоза собак

  3. Определение болезни

  4. Иксодовые клещи

  5. Морфология и биология возбудителя

  6. Этиология и патогенез болезни

  7. Диагностика болезни

  8. Лечение

  9. Профилактика

  10. Комплекс противопаразитарных мероприятий

  11. Список литературы

Введение

Эта болезнь известна уже давно, ее исследовали еще в начале прошлого века (Pianj et GalliVarerio — 1895, Christophers — 1907, Джунковский — 1909, Якимов — 1913). Раньше ее называли лесной болезнью, так как собаки заболевали после прогулки по лесу. В России бабезиоз собак впервые был выявлен в 1909 году.

Пироплазмоз вызывается паразитом Piroplasma canis (по международной классификации он называется Babesia canis, а сама болезнь — бабезиоз собак). Пироплазма локализуется в плазме крови, эритроцитах и других элементах крови, реже — во внутренних органах. Переносчиками болезни служат взрослые иксодовые (пастбищные) клещи, которые являются обязательным звеном в эпизоотической цепи возбудитель-переносчик-животное. Находясь в лесу, на поле с кустарниками или в парке, собаки могут подвергаться нападению клещей, которые чаще всего присасываются на голове, шее и на внутренней поверхности бедер.

Характерной особенностью пироплазмоза является очаговость и сезонность возникновения, которые обусловлены зоной обитания клещей и периодами их активности. В средней полосе заболевание обычно регистрируется с начала мая до июля и с конца августа до октября. Основным фактором, влияющим на активность клещей, является температура. В отдельные годы случаи пироплазмоза отмечаются до конца октября, что связано также с климатическими условиями. Естественно, что в южных регионах случаи заболевания отмечаются в более ранние и поздние сроки.

Не смотря на то, пироплазмоз не характерен для северо-западного региона, последнее время он становится значительной проблемой для собаководов Санкт-Петербурга и области. Увеличилось количество привозных собак, которые плохо адаптированы к местным условиям и более подвержены инвазии. Возросло число бродячих собак, на которых клещи «кормятся». Участились случаи нетипичного течения болезни и ее совмещения с другими инфекционными заболеваниями, что нередко приводит к летальному исходу. Все это наносит удар по репутации ветеринарных врачей и причиняет значительный моральный и материальный ущерб владельцам собак. Следует отметить, что практикующие врачи часто встречаются с различной симптоматикой, когда желтуха и гемоглобинурия, долгое время считавшиеся непременными признаками пироплазмоза, слабо выражены или не проявляются постоянно. Практически невозможно поставить диагноз только по клиническим признакам. Единственным бесспорным фактором точной диагностики является выявление паразита в мазках крови.

Бабезиоз/пироплазмоз — симптомы, профилактика, лечение

Рассказывает врач интенсивной терапии, руководитель ОРИТ ветеринарной клиники “Эксвет” Юлия Гурина.

Когда говорят “клещ у собаки”, чаще всего имеются в виду иксодовые клещи — паразиты, живущие в траве в теплый период года. Именно с этими паразитами связан бабезиоз — заболевание собак, которое без своевременной помощи может быстро привести к смерти. Раньше в Одессе бабезиоз регистрировали крайне редко, в основном, у собак, которых вывозили за пределы города. Но в последние три года — очень часто.

Теперь по порядку.

Что такое бабезиоз

Бабезиоз (то же, что пироплазмоз) — это трансмиссивное (передающееся насекомыми и клещами, в данном случае клещами) заболевание. По сути это заражение внутриклеточными паразитами — бабезиями, которые попадают в кровь собаки при укусе клеща.

Бабезии опасны тем, что поражают и разрушают эритроциты. Возникает анемия, поражаются жизненно важные органы, в первую очередь, почки.

Иксодовые клещи Бабезии в эритроцитах

Симптомы бабезиоза после укуса клеща у собаки следующие

  • бледные или желтые слизистые оболочки, 
  • слабость, 
  • иногда рвота, диарея,
  • концентрированный цвет мочи, вплоть до красно-коричневого,
  • повышение температуры до 40° и выше,
  • отказ от еды.

Диагностика бабезиоза

• мазок на бабезиоз. Бабезий легче всего обнаружить в мелких периферических капиллярных сосудах, поэтому кровь берем из сосудов ушной раковины.

  • ПЦР-исследование на бабезиоз.
  • клинические признаки.

Лечение собаки после укуса клеща в случае заражения бабезиозом

Бабезиоз лечится в зависимости от тяжести заболевания. Чаще всего лечение проходит в условиях отделения интенсивной терапии.

  1. Вводим препарат, убивающий бабезий (Пиро-стоп или Азидин). Препарат вводим дважды или более раз, в зависимости от тяжести заболевания.
  2. Проводим инфузионную терапию для коррекции обезвоживания, симптоматическую терапию.
  3. Проводим кислородотерапию. Это важно, потому что эритроциты – это те клетки крови, которые переносят кислород к органам, и если эритроциты разрушаются и их становится критически мало, кислорода внутренним органам не хватает для того, чтобы нормально выполнять свою функцию. 
  4. В тяжелых случаях необходимо переливание свежей цельной крови или эритроцитарной массы. Делается это для того, чтобы восстановить количество эритроцитов в организме и улучшить кровоснабжение внутренних органов. Перед переливанием эритроцитов или свежей цельной крови нам необходимо проверить совместимость донора и реципиента. Для этого мы используем специальные тест-системы на группу крови. Благодаря тому, что в нашей клинике есть банк крови, мы можем питомцу оказать помощь в полном объеме.
  5. Постоянно мониторим общее состояние, проводим анализы – общий анализ крови, биохимические показатели почек, мазки крови на наличие паразита. Анализы проводятся для того, чтобы вовремя отреагировать на изменения в организме и скорректировать лечение, если требуется.

В среднем на лечение бабезиоза уходит от 2 дней до 3 недель. Как правило, прогноз от осторожного до благоприятного.

Как избежать бабезиоза

Профилактика заражения бабезиями — это профилактика клещей у собак. Регулярно обрабатывайте собак препаратами от клещей! Начинайте обработку заранее, до потепления температуры, а лучше — круглогодично. Не нарушайте график обработок, не дожидайтесь перерыва между обработками! Строго следуйте инструкции к препарату.

Самые эффективные на сегодняшний день — оральные формы препаратов (таблетки). Такой способ особенно актуален для питомцев, которые летом регулярно плавают. Это будет защищать собаку надежно и безопасно. Таблетки — Симпарика, Нексгард Спектра, Бравекто — покупайте только в специализированных, надежных местах продаж, опасайтесь подделок и нелегальных препаратов. Капли на холку  Адвантикс, ошейник от клещей Форесто также надежные средства защиты при правильном применении. 

Особое внимание обратите, когда вы с собакой выбираетесь на природу или на дачу. Если клещей очень много, используйте дополнительные средства защиты — аэрозоли. Обязательно регулярно осматривайте собаку на предмет клещей, которые обычно локализируются у основания ушей, или на ушах, в области подмышек, паха и на гениталиях.

Как действовать, если у собаки клещ

  1. Клеща нужно правильно снять — выкрутить. Крутить можно в любую сторону — по часовой стрелке или против. Можно использовать специальные выкручиватели клещей, которые продаются в зоомагазинах.
  2. Когда клеща извлекли, проверьте, достали ли его полностью, не оторвалась ли голова. Место укуса обработайте антисептиком (например, хлоргексидином), потому что может возникнуть местная реакция.
  3. Обязательно обратитесь к врачу! Это нужно для поиска других клещей на собаке, потому что не всегда владелец может заметить всех паразитов. Кроме того,  врач возьмет мазок на бабезиоз. Причем это нужно делать как сразу, так и на 3, 5, 7 день. Не в каждом мазке крови можно сразу обнаружить бабезий. В начале заболевания, когда они не успели размножиться, найти их непросто. При обнаружении бабезий собаке проведут соответствующее лечение.

 

Будьте внимательны к своим питомцам!

Пироплазмоз у кошек: симптомы и лечение

Действительно ли высока вероятность заразиться от домашнего питомца?

В последнее время, благодаря интернету, СМИ и всевозможным научным изданиям, владельцы животных стали все больше и больше ориентироваться в названиях болезней, разбираться в заболеваниях своих питомцев и лучше следить за их состоянием. Но это, одновременно, и вызывает излишнюю панику. Так случилось и с пироплазмозом, тяжелым заболеванием животных, который совершенно безопасен для человека.

Пироплазмоз у кошек обнаружили только в 2005 году (ранее было признано только у собак). Пироплазмоз (бабезиоз) — болезнь дачного сезона, ее начало приходится на апрель-май, с момента потепления, и заканчивается в октябре-ноябре, с первыми холодами. Такой промежуток времени неслучаен. Переносчиком заболевания является иксодовый клещ, зараженный пироплазмой. С укусом этого клеща в кровь животного поступают одноклеточные организмы — пироплазмы (бабезии), которые начинают разрушать красные клетки крови (эритроциты), несущие кислород по всему организму.

Этот процесс вызывает кислородное голодание организма, слизистые больного животного становятся бледными. Уровень свободного гемоглобина повышается пропорционально интенсивности распада эритроцитов. Организм не может быстро вывести и переработать свободный гемоглобин, поэтому образуется прямой билирубин — очень токсичный продукт, отравляющий весь организм, поражающий почки, печень и центральную нервную систему. Этот процесс настолько быстрый, что животное может погибнуть через 3–4 дня после укуса клеща.

Симптомы заболевания могут проявляться на 2-й — 7-й день. Течение болезни очень быстрое. Если вашу кошку или собаку укусил клещ, очень внимательно наблюдайте за ней. Меряйте температуру дважды в день. Повышенная температура (40…41) в сочетании с общей апатией, отказом от еды, бледными слизистыми век и рта — уже веское основание обратиться к ветеринару. У больного животного может быть рвота, моча становится красного, бурого цвета из-за того, что почки не в состоянии отфильтровать разрушенные эритроциты, животное может тяжело дышать, с трудом передвигаться.
В случае заболевания животное нужно как можно скорее доставить в ветеринарную клинику, сдать кровь на мазок (лучше сделать срочный анализ) и начать лечение под строгим наблюдением ветеринарного врача.
Успех лечения целиком зависит от того, на какой стадии оно начато: чем быстрее вы обратитесь к специалисту, тем больше шансов, что животное полностью поправится. Само лечение может занять от нескольких дней до двух-трех недель.

Профилактика

Чтобы уберечь вашего питомца от болезни, следует придерживаться следующих профилактических рекомендаций:

  • Если ваша кошка или собака выходит на улицу или поедет на дачу, обязательно обрабатывайте ее средствами против клещей. Это могут быть спреи, капли, ошейники — у каждой формы свои сроки начала действия после обработки и время эффективной защиты.
  • Перед применением убедитесь, что срок годности не вышел. Приобретайте средства только в проверенных зоомагазинах.
  • Старайтесь как можно чаще осматривать питомца, проверяя наличие клещей.
  • В случае обнаружения клеща необходимо как можно быстрее удалить его. Следует помнить, что при этом, нужно соблюдать осторожность, так как легко можно оторвать хоботок или голову клеща, которые останутся в коже животного и вызовут воспалительные процессы. В аптеках для животных продаются специальные приспособления для удаления клещей. Обычно это крючок, похожий на двузубую изогнутую вилку. Для того чтобы удалить насекомое, его зацепляют этим крючком так, чтобы он оказался между зубьями, и аккуратно «вытаскивают» из кожи.
  • Обрабатывайте животное защитными средствами строго по инструкции (обычно, каждые 21–28 дней). Соблюдайте рекомендации производителей инсектицидных ошейников по срокам применения и регулярно очищайте их если те пачкаются или засаливаются, своевременно меняйте пришедшие в негодность.

Пироплазмоз не опасен для человека, но очень опасен для животных. Любите и берегите своего питомца, заботьтесь о нем, проводите профилактические меры вовремя — тогда, к вашей общей радости, все болезни обойдут его стороной.

Признаки пироплазмоза у собак и способы лечения


Пироплазмоз относится к одному из наиболее опасных заболеваний у собак. При отсутствии должного лечения возможен летальный исход. Поэтому важно разобраться, как распознать заболевание у питомца и можно ли его защищать от пироплазмоза. СОДЕРЖАНИЕ:

Как происходит заражение, и какие клещи заразные?

Заражение происходит при укусе клеща. При присасывании паразита к собаке, он впрыскивает в образовавшуюся ранку собственную слюну. В ней содержится вещества, не позволяющие крови сворачиваться. Из-за особой слюны клеща, которая обезболивает место укуса, собаки не чувствуют дискомфорта. Также в жидкости паразита содержатся различные микроорганизмы, включая бабезии. Именно они вызывают пироплазмоз (другое название — бабезиоз). 

Не все клещи являются переносчиками этого заболевания. Пироплазмозом заражают иксодовые паразиты. Самостоятельно определить вид клеща не получится. Это возможно только при лабораторных исследованиях. Поэтому, обнаружив на теле питомца паразита, лучше проверить его.

Клещ не бегает за жертвой и не прыгает на нее. Он ползет вверх по траве, поднимает лапки и ждет, когда сможет зацепиться за жертву. Чем дольше он будет находиться на теле собаки, тем выше вероятность заражения. В некоторых случаях возбудители проникают в организм питомца сразу же с момента укуса.

Инкубационный период и симптомы пироплазмоза

Инкубационный период данного заболевания зависит от состояния питомца. Ослабленные особи быстрее заболевают и тяжелее переносят болезнь. Поэтому инкубационный период может длиться от 5 дней до 3 недель. Первые симптомы проявляются при разрушении значительного количества эритроцитов. Среди основных признаков заболевания:

  1. Смена в поведении питомца, появилась вялость, апатия.
  2. Увеличение температуры тела.
  3. Дыхание стало учащенным.
  4. Пес отказывается от прогулок.
  5. Аппетит снижается или вовсе отсутствует.
  6. Рвота, диарея. 

Одним из ключевых признаков пироплазмоза является потемнение мочи. При проявлении указанных симптомов необходимо обратиться к ветеринару. В противном случае состояние собаки будет ухудшаться. На слизистых глаз и рта появится желтый оттенок, задние конечности полностью ослабнут. Отказ от пищи, и одышка будут только усиливаться. Возникнет почечная недостаточность, в моче может появиться кровь. В особенно запущенных случаях моча чернеет.

Формы течения болезни

Заболевание протекает в острой и хронической формах. В первом случае описанные признаки заболевания проявляются ярко. Иногда летальный исход наступает на третий день после появления явных симптомов. При хронической форме заболевание может не проявляться долгое время. На пироплазмоз иногда указывает лишь смена в поведении питомца. Главная опасность в том, что хозяин может проигнорировать такие сигналы и не обратиться к доктору с любимцем. Летальный исход возможен через 1-2 месяца с момента заражения.

Хроническая форма часто наблюдается у животных, которые ранее уже переносили пироплазмоз.


Диагностика

Отмечалось, что не каждый клещ может заразить пироплазмозом. Поэтому при обнаружении паразита на теле питомца или подозрениях, что любимца могли укусить, необходимо тщательно следить за состоянием животного. При проявлении хотя бы одного из вышеописанных симптомов следует сразу же обратиться к ветеринару.

Доктор возьмет у собаки кровь на анализ на пироплазмоз. Материал для анализа берется из уха или пальца. На ранней стадии паразиты в крови не всегда возможно обнаружить. Поэтому если анализ чистый, но признаки заболевания продолжают проявляться, рекомендуется провести исследование повторно.

Лечение и реабилитация

После подтверждения диагноза, доктор назначает лечение питомцу. Это комплексная терапия, направленная на избавление от паразитов, вывод токсинов из организма. В особо тяжелых случаях может потребоваться переливание крови. Дополнительно могут назначить препараты, направленные на поддержание работы сердца и легких. Ветеринар может рекомендовать прием витаминных комплексов, иммуномодуляторов.

Некоторые доктора назначают гепатопротекторы. Но их следует использовать, только если у питомца серьезно пострадали клетки печени.

При успешном излечении от заболевания питомец нуждается в реабилитации. На протяжении минимум месяца любимцу назначается особый режим питания и прогулок. Не рекомендуется перегружать собаку в этот период. Стоит отказаться от выставок, соревнований, больших физических нагрузок, дальних поездок. Питомцу нужен полноценный отдых и покой.

Профилактика

Сократить вероятность наступления пироплазмоза можно при помощи профилактических средств. Она направлены на предотвращение попадания клеща на собак, а также. Среди подобных средств: 

  1. Спрей. Оказывают кратковременную защиту. Используются перед поездкой на природу в качестве дополнительной меры профилактики.
  2. Ошейник. Также рекомендуется сочетать с другими методами защиты.
  3. Таблетки. Считаются одними из надежных средств защиты от клещей. Действуют длительное время.
  4. Капли. Их наносят на холку каждые несколько недель. Обладают хорошим уровнем защиты.

Для более надежной защиты рекомендуется комбинировать профилактические средств и использовать 2 из них одновременно, чтобы усилить эффект. Также следует носить с собой специальный выкручиватель, позволяющий осторожно удалять клещей с тела собаки.

Пироплазмоз является серьезным заболеванием. Даже после успешного лечения у питомца могут наблюдаться некоторые проблемы со здоровьем. Поэтому рекомендуется внимательно следить за состоянием любимца и при первых признаках болезни обращаться к ветеринару.

Пироплазмоз (бабезиоз) собак | Ветеринарная клиника «Феликс»

Пироплазмоз (бабезиоз) собак – кровепаразитарное протозойное заболевание, которую вызывает паразит babesia canis. Заражение происходит при укусе инфицированного клеща. Для человека не опасно. Бабезиоз кошек существует, но в центральном регионе встречается крайне редко.

Симптомы и течение. Инкубационный период составляет 6-10 дней. При остром течении температура тела собаки повышается до до 40-42 С. Через 2-3 дня температура падает ниже нормы. У больных собак снижается или отсутствует аппетит. Общее состояние угнетенное, наблюдается вялость, дыхание учащенное. Слизистые оболочки бледные или желтые (иктеричные). Моча с развитием заболевания темнеет, затем приобретает красный цвет. Стул становится оранжевым. Без вовремя начатого лечения животное погибает.

При хроническом течении отмечается вялость, в начале заболевания может наблюдаться повышение температуры тела до 41 С, желтушность слизистых оболочек, гемоглобинурия (моча темного или красного цвета), диарея (понос). Периодически состояние улучшается, затем снова наступает депрессия. Болезнь может длиться 3-6 недель и может закончиться гибелью животного.

Для лечения пироплазмоза (бабезиоза)применяются противопротозойные препараты. Это токсичные вещества, которые не только убивают паразита, но и отравляют организм собаки. Для снятия интоксикации, вызванной как заболеванием, так и препаратом, проводят инфузионную и поддерживающую терапию (капельницы). В зависимости от результатов анализов крови животного может быть добавлена симптоматическая терапия для восстановления работы почек, печени.

Прогноз заболевания зависит от того, как быстро владельцы обратились в ветклинику. На ранних стадиях заболевания у молодых, сильных животных чаще всего лечение занимает 3 дня. У слабых, истощенных животных или у собак, которых привели в клинику уже с ярко выраженными симптомами, лечение может занять длительное время, болезнь может окончиться гибелью собаки в результате осложнений работы почек, печени, головного мозга и др.

Профилактика. Эффективной вакцины от бабезиоза собак на данный момент не существует. Применение противопротозойных препаратов под видом «вакцин» может нанести животному больше вреда, чем пользы. Поэтому единственным средством, которое позволяет снизить вероятность заболевания собаки бабезиозом в районах, неблагополучных по пироплазмозу, остается обработка животного от клещей. Рекомендуется тройная защита: капли на холку 1 раз в 3 недели, антиклещевой ошейник, который необходимо менять 1 раз в месяц, и спрей от клещей перед каждой прогулкой. К сожалению, бывает так, что несмотря на все принятые меры, клещ всё же кусает собаку и заражает её пироплазмозом. В этом случае необходимо экстренное обращение в ветеринарную клинику при первых признаках недомогания у животного.

Ветеринарный врач, кардиолог, специалист по УЗИ

Пироплазмоз у кошек: симптомы, профилактика, лечение

Заболевания, передающиеся через укус клещей, встречаются у домашних и диких животных во всём мире. Пироплазмоз, он же бабезиоз (это названия одной и той же болезни) в нашей стране повсеместно встречается у собак, однако в последние годы единичные случаи описаны и у кошек.

В мире случаи бабезиоза кошек зарегистрированы в Европе (Франция, Германия, Польша и Испания) и Азии (Израиль, Индия и Пакистан). Молекулярные исследования показали, что кошки могут содержать множество видов бабезий.

Пироплазмоз у кошек: главное

  • Заболевание не характерно для России;

  • Бабезиоз кошек является серьезной проблемой ветеринарии только в Южной Африке;

  • Для болезни характерно хроническое течение без периодов высокой температуры, обычно отмечают вялость и слабость питомца;

  • Прогноз зависит от серьезности заболевания, которая, в свою очередь, зависит как от факторов организма, так и от факторов хозяина;

  • Сообщается о смертности от 15 до 20%.

 

Причины заболевания

Бабезиоз – это клещевое простейшее заболевание, вызываемое паразитами рода Babesia, принадлежащими к Piroplasmida. Именно поэтому заболевание известно и как бабезиоз, и как пироплазмоз.

Бабезии представляют собой простейших одноклеточных паразитов, которые развиваются в эритроцитах животных и питаются их содержимым (гемоглобином). Во всем мире существуют многочисленные виды бабезий. В основном паразит видоспецифичен, то есть определенный вид паразита может быть опасен только для определённого вида животных. Например, babesia canis заражает собак, babesia equi – лошадей, babesia felis – кошек и т. п. Однако благодаря развитию науки, в частности молекулярной генетики, стало известно, что у кошек встречаются разные виды бабезий. На данный момент у кошек обнаружено паразитирование четырёх видов бабезий: это Babesia felis, Babesia cati, Babesia herpailuri и Babesia pantherae.

Babesia felis, впервые обнаруженная у диких кошек в Судане, впоследствии была признана основной причиной клинического заболевания домашних кошек. Хотя о бабезиозе домашних кошек периодически сообщали из разных стран, как серьезное заболевание он, по-видимому, явно характерен только для Южной Африки. Причём бабезиоз кошек регулярно регистрируется только в прибрежных регионах. Предполагается, что инфекция передается клещом, но переносчик на данный момент до сих пор не идентифицирован.

Симптомы пироплазмоза

Пироплазмоз у кошек, в отличие от аналогичного заболевания у собак, как правило, не сопровождается повышением температуры тела. Чаще всего единственными признаками владельцы отмечают похудение питомца и его вялость. К основным симптомам пироплазмоза относят бледность слизистых оболочек, удрученное состояние животных, в некоторых случаях развивается желтуха. Часто у кошек наблюдаются сочетанные инфекции (например, микоплазмоз, лейкоз, иммунодефицит), которые могут влиять на проявление заболевания.

Диагностика

Золотым стандартом в диагностике пироплазмоза у кошек является выявление паразитов в мазке крови из уха (выявляются включения в эритроцитах), однако окончательный диагноз с определением вида паразита ставится путём ПЦР-исследования крови (полимеразной цепной реакции).

К дополнительным методам диагностики относят общий и биохимический анализы крови.

По общему анализу крови обычно отмечают регенеративную анемию, по биохимии крови – повышение уровня аланинтрансаминазы (но не щелочной фосфатазы) и общего билирубина, а также различные нарушения электролитного баланса. Иногда может наблюдаться вторичная иммуноопосредованная гемолитическая анемия.

Лечение пироплазмоза

Учитывая редкость данного заболевания, лечение на данный момент не до конца разработано. Считается, что основные лекарственные препараты, эффективные против других видов бабезий (имидокарба дипропионат, диминазена диацетурат), являются малоэффективными средствами против пироплазмоза кошек. Основой терапии являются противопротозойные препараты и поддерживающая терапия. Примахин фосфат считается препаратом выбора для кошек. Препарат вводят как внутрь, так и внутримышечно. Причём стоит отметить, что примахин фосфат оказывает клиническое выздоровление, однако кошка часто остаётся носителем заболевания. Часто требуется повторное введение препарата или даже длительное лечение.

Также применяют поддерживающую и симптоматическую терапию в зависимости от симптомов пироплазмоза (внутривенную инфузионную терапию, витаминные препараты, переливание крови и т. п.).

Профилактика

Несмотря на то что переносчик кошачьего бабезиоза на данный момент не обнаружен, вероятнее всего, им является один из многочисленных видов клещей. Поэтому к основным средствам профилактики относят различные капли от клещей, а также ошейники и спреи – например, на основе флураланера, фипронила и т. п. Не рекомендуется использовать в качестве защитной терапии препараты на основе экстрактов растений, так как на практике доказана их неэффективность.

Опасность для человека

Как уже сообщалось выше, бабезиоз – это видоспецифичное заболевание, и случаев заболевания человека пироплазмозом кошек в литературе не описано. Более того, основной путь передачи заболевания – через укус клеща, между животными и между животным и человеком путей передачи не было обнаружено.

Статья была полезна?

Спасибо, давайте дружить!

Подписывайтесь на наш Инстаграмм

Подписаться

Спасибо за обратную связь!

Давайте дружить — скачайте приложение Petstory

4 августа 2021

Обновлена: 4 августа 2021

Роман Babesia sp. связаны с клиническими признаками бабезиоза у домашних кошек в Южной Африке | Паразиты и переносчики

  • 1.

    Driscoll CA, Menotti-Raymond M, Roca AL, Hupe K, Johnson WE, Geffen E, et al. Ближневосточное происхождение приручения кошек. Наука. 2007; 317: 519–23.

    CAS Статья Google ученый

  • 2.

    Driscoll CA, Macdonald DW, O’Brien SJ. От диких животных до домашних животных — эволюционный взгляд на одомашнивание.Proc Natl Acad Sci USA. 2009; 106 (Приложение 1): 9971–8.

    CAS Статья Google ученый

  • 3.

    Якобсон Л.С., Шеман Т., Лобетти Р.Г. Обследование бабезиоза кошек в Южной Африке. J S Afr Vet Assoc. 2000; 71: 222–8.

    CAS PubMed Google ученый

  • 4.

    Penzhorn BL, Stylianides E, Coetzee MA, Viljoen JM, Lewis BD. Очаг кошачьего бабезиоза в Kaapschehoop на откосе Мпумаланги.J S Afr Vet Assoc. 1999; 70: 60.

    CAS Статья Google ученый

  • 5.

    Дэвис Л.Дж. На пироплазме суданской дикой кошки ( Felis ocreata ). Trans R Soc Trop Med Hyg. 1929; 12: 523–33.

    Google ученый

  • 6.

    Wenyon CM. Протозоология. Лондон: Байер, Тиндалл и Кокс; 1926.

    Google ученый

  • 7.

    Джексон С., Даннинг Ф.Дж. Желчная лихорадка (нутталиоз) кошки: случай в районе Стелленбош. J S Afr Vet Med Assoc. 1937; 8: 83–7.

    Google ученый

  • 8.

    Макнил Дж. Пироплазмоз домашней кошки. J S Afr Vet Med Assoc. 1937; 8: 88–90.

    Google ученый

  • 9.

    Du Toit PJ. Zur Systematik der · Пироплазмен. Arch Protist. 1918; 39: 81–104.

    Google ученый

  • 10.

    Carpano M. Sulle piroplasmi dei carnivori e su di un nuovo piroplasma de felini ( Babesiella felis ) nel puma: Felis concolor . Боллеттино № 137. Каир: Serviz Tecn Scient Min Dell Agric .; 1934.

  • 11.

    Futter GJ, Belonje PC. Исследования бабезиоза кошек. 2. Клинические данные. J S Afr Vet Assoc. 1980; 51: 143–6.

    CAS PubMed Google ученый

  • 12.

    Potgieter FT. Химиотерапия инфекции Babesia felis : эффективность некоторых препаратов.J S Afr Vet Assoc. 1980; 51: 289–93.

    Google ученый

  • 13.

    Penzhorn BL, Lewis BD, López-Rebollar LM, Swan GE. Скрининг пяти препаратов на эффективность против Babesia felis у экспериментально инфицированных кошек. J S Afr Vet Assoc. 2000. 71: 53–7.

    CAS PubMed Google ученый

  • 14.

    Бенсон Д.А., Кавано М., Кларк К., Карш-Мизрахи И., Липман Д.Д., Остелл Дж. И др.GenBank. Nucl Acids Res. 2013; 41 (Выпуск базы данных): D36–42.

    CAS PubMed Google ученый

  • 15.

    Bosman AM, Venter EH, Penzhorn BL. Встречаемость Babesia felis и Babesia leo у различных видов диких кошачьих и домашних кошек в южной части Африки, на основе анализа блоттинга обратной линии. Vet Parasitol. 2007; 144: 33–8.

    Артикул Google ученый

  • 16.

    Уильямс Б.М., Берентсен А., Шок BC, Тейксьера М., Данбар М.Р., Беккер М.С. и др. Распространенность и разнообразие Babesia , Hepatozoon , Ehrlichia и Bartonella у диких и домашних хищников из Замбии, Африка. Parasitol Res. 2014; 113: 911–8.

    Артикул Google ученый

  • 17.

    Стюарт К.Г., Хакетт К.Дж.В., Коллетт М.Г. Неопознанная Babesia домашней кошки ( Felis domesticus ).J S Afr Vet Assoc. 1980; 51: 219–22.

    CAS PubMed Google ученый

  • 18.

    Банет Г., Кенни М.Дж., Таскер С., Ануг Ю., Шкап В., Леви А. и др. Заражение предложенным новым подвидом Babesia canis , Babesia canis subsp. presentii , у домашних кошек. J Clin Microbiol. 2004. 42: 99–105.

    CAS Статья Google ученый

  • 19.

    Dennig HK. Babesieninfektionen bei exotischer Katzen и die Bedeutung dieser Blutparasiten für die tierärtzliche Forschung. Acta Zool Pathol Antverpiensia. 1969; 48: 361–7.

    CAS Google ученый

  • 20.

    Dennig HK, Brocklesby DW. Babesia pantherae sp. nov., пироплазма леопарда ( Panthera pardus ). Паразитология. 1972; 64: 525–32.

    CAS Статья Google ученый

  • 21.

    Dennig HK. Eine unbekannte Babesienart beim Jaguarundi ( Herpailurus yaguarondi ). Kleintierpraxis. 1967; 12: 146–50.

    Google ученый

  • 22.

    Bosman AM, Oosthuizen EC, Peirce MA, Venter EH, Penzhorn BL. Babesia lengau sp. nov., новый вид Babesia в популяциях гепарда ( Acinonyx jubatus Schreber, 1775) в Южной Африке. J Clin Microbiol. 2010. 48: 2703–8.

    Артикул Google ученый

  • 23.

    Bosman AM, Oosthuizen MC, Venter EH, Steyl JC, Gous TA, Penzhorn BL. Babesia lengau , ассоциированная с церебральным и гемолитическим бабезиозом у двух домашних кошек. Векторы паразитов. 2013; 6: 128.

    CAS Статья Google ученый

  • 24.

    Нейхоф А.М., Пенжорн Б.Л., Линен Дж., Моллель Дж. О., Моркель П., Беккер КПЖ и др. Babesia bicornis sp. ноя и Theileria bicornis sp. nov .: клещевые паразиты, связанные со смертностью черных носорогов.J Clin Microbiol. 2003. 41: 2249–54.

    Артикул Google ученый

  • 25.

    Нейхоф А.М., Пиллэй В., Стейл Дж., Прозески Л., Штольц У.Х., Лоуренс Дж. А. и др. Молекулярная характеристика видов Theileria , связанных со смертностью четырех видов африканских антилоп. J Clin Microbiol. 2005; 43: 5907–11.

    CAS Статья Google ученый

  • 26.

    Тембо С., Коллинз Н. Э., Сибеко-Матджила К. П., Троски М., Форстер И., Бьяруханга С. и др.Распространение клещевых гемопаразитов у крупного рогатого скота в районе Мунгви, Северная провинция, Замбия. Клещи Tick Borne Dis. 2018; 9: 707–17.

    Артикул Google ученый

  • 27.

    Sibeko KP, Oosthuizen MC, Collins NE, Geysen D, Rambritch NE, Latif AA, et al. Разработка и оценка теста полимеразной цепной реакции в реальном времени для обнаружения инфекций Theileria parva у мысов буйволов ( Syncerus caffer ) и крупного рогатого скота.Vet Parasitol. 2008; 155: 37–48.

    CAS Статья Google ученый

  • 28.

    Bekker CPJ, de Vos S, Taoufik A, Sparagano OAE, Jongejan F. Одновременное обнаружение видов Anaplasma и Ehrlichia у жвачных животных и обнаружение Ehrlichia ruminantium с помощью клещей Amblyumomma линейная блот-гибридизация. Vet Microbiol. 2000. 89: 223–38.

    Артикул Google ученый

  • 29.

    Gubbels J, De Vos A, Van Der Weide M, Viseras J, Schouls LM, De Vries E, et al. Одновременное обнаружение коров видов Theileria и Babesia с помощью блот-гибридизации с обратной линией. J Clin Microbiol. 1999; 37: 1782–9.

    CAS PubMed PubMed Central Google ученый

  • 30.

    Oosthuizen MC, Zweygardt E, Collins NE, Troskie M, Penzhorn BL. Идентификация романа Babesia sp.от соболяной антилопы ( Hippotragus niger Harris, 1838). Vet Parasitol. 2008; 163: 39–46.

    Артикул Google ученый

  • 31.

    Matjila PT, Leisewitz AL, Oosthuizen MC, Jongejan F, Penzhorn BL. Обнаружение видов Theileria у собак в Южной Африке. Vet Parasitol. 2008; 157: 34–40.

    CAS Статья Google ученый

  • 32.

    Стаден Р., Бил К.Ф., Бонфилд Дж.Стандартный пакет, 1998. Методы Mol Biol. 2000; 132: 115–30.

    CAS PubMed Google ученый

  • 33.

    Альтшул С.Ф., Гиш В., Миллер В., Майерс Е.В., Липман Д. Базовый инструмент поиска локального выравнивания. J Mol Biol. 1990; 215: 403–10.

    CAS Статья Google ученый

  • 34.

    Кумар С., Стечер Г., Тамура К. MEGA7: Анализ молекулярной эволюционной генетики, версия 7.0 для больших наборов данных. Mol Biol Evol. 2016; 33: 1870–4.

    CAS Статья Google ученый

  • 35.

    Кимура М. Простой метод оценки скорости эволюции замен оснований посредством сравнительных исследований нуклеотидных последовательностей. J Mol Evol. 1980; 16: 111–20.

    CAS Статья Google ученый

  • 36.

    Сайтоу Н., Ней М. Метод объединения соседей: новый метод реконструкции филогенетических деревьев.Mol Biol Evol. 1987. 4: 406–25.

    CAS PubMed Google ученый

  • 37.

    Фельзенштейн Дж. Пределы уверенности в филогении: подход, использующий бутстрап. Эволюция. 1985; 39: 783–91.

    Артикул Google ученый

  • 38.

    Хасегава М., Кишино Х., Яно Т. Датирование расщепленного человека-обезьяны по молекулярным часам митохондриальной ДНК. J Mol Evol. 1985; 22: 160–74.

    CAS Статья Google ученый

  • 39.

    Шнитгер Л., Родригес А.Е., Флорин-Кристенсен М., Моррисон Д.А. Бабезия : новый мир. Inf Gen Evol. 2012; 12: 1788–809.

    Артикул Google ученый

  • 40.

    Penzhorn BL, Kjemtrup AM, López-Rebollar LM, Conrad PA. Babesia leo n. sp. от львов в Национальном парке Крюгера, Южная Африка, и его связь с другими пироплазмами. J Parasitol. 2001; 87: 881–5.

    Артикул Google ученый

  • 41.

    Phair K, Carpenter JW, Smee N, Myers CB, Pohlman LM. Тяжелая анемия, вызванная бабезиозом у гривистого волка ( Chrysocyon brachyurus ). J Zoo Wildl Med. 2012; 43: 162–7.

    Артикул Google ученый

  • 42.

    Wasserkrug Naor A, Lindemann DM, Schreeg ME, Marr HS, Birkenheuer AJ, Carpenter JW, et al. Клинические, морфологические и молекулярные характеристики неопределенного вида Babesia у гривистого волка ( Chrysocyon brachyurus ).Клещи Tick Borne Dis. 2019; 10: 124–6.

    Артикул Google ученый

  • 43.

    Биркенхойер А.Дж., Уиттингтон Дж., Нил Дж., Лардж Э., Баргер А., Леви М.Г. и др. Молекулярная характеристика видов Babesia , идентифицированных у североамериканского енота. J Wildl Dis. 2006; 42: 375–80.

    CAS Статья Google ученый

  • 44.

    Джиннаи М., Кавабучи-Курата Т., Цудзи М., Накадзима Р., Фудзисава К., Нагата С. и др.Молекулярные доказательства присутствия новых видов Babesia у одичавших енотов ( Procyon lotor ) на Хоккайдо, Япония. Vet Parasitol. 2009; 162: 241–7.

    CAS Статья Google ученый

  • 45.

    Кавабути Т., Цуки М., Садо А, Матоба Y, Асакава М., Исихара С. Паразиты, похожие на Babesia microti , обнаружены у диких енотов ( Procyon lotor ), пойманных на Хоккайдо, Япония. Jpn J Vet Med Sci.2005; 67: 825–7.

    Артикул Google ученый

  • 46.

    Inokuma H, Yoshizaki Y, Shimada Y, Sakata Y, Okuda M, Onishi T. Эпидемиологическое обследование видов Babesia в Японии, проведенное с образцами клещей, собранных у собак, и обнаружение новой ДНК Babesia связаны с ДНК Babesia odocoilei и Babesia divergens . J Clin Microbiol. 2003. 41: 3494–8.

    CAS Статья Google ученый

  • 47.

    Gubbels M, Hong Y, van der Weide M, Qi B, Nijman IS, Guangyuan L, et al. Молекулярная характеристика группы Theileria buffeli / orientalis . Int J Parasitol. 2000; 30: 943–52.

    CAS Статья Google ученый

  • 48.

    Birkenheuer AJ, Levy MG, Breitschwerdt EB. Разработка и оценка семенной ПЦР для обнаружения и дифференциации Babesia gibsoni (азиатский генотип) и B.canis ДНК в образцах крови собак. J Clin Microbiol. 2003. 41: 4172–7.

    CAS Статья Google ученый

  • 49.

    Schnittger L, Yin H, Gubbels MJ, Beyer D, Niemann S, Jongejan F, et al. Филогения паразитов овец и коз Theileria и Babesia . Parasitol Res. 2003. 91: 398–406.

    Артикул Google ученый

  • 50.

    Chae JS, Allsopp BA, Waghela SD, Park JH, Kakuda T., Sugimoto C, et al.Изучение систематики Theileria spp. на основе последовательностей гена рибосомной РНК с малой субъединицей. Parasitol Res. 1999; 85: 877–83.

    CAS Статья Google ученый

  • 51.

    Allsopp MT, Allsopp BA. Свидетельство молекулярной последовательности для реклассификации примерно видов Babesia . Ann NY Acad Sci. 2006; 1081: 509–17.

    CAS Статья Google ученый

  • 52.

    Caccio SM, Antunovic B, Moretti A, Mangili V, Marinculic A, Slemenda SB и др. Молекулярная характеристика Babesia canis canis и Babesia canis vogeli от естественно инфицированных европейских собак. Vet Parasitol. 2002; 106: 285–92.

    CAS Статья Google ученый

  • 53.

    Кьемтруп А.М., Уэйнрайт К., Миллер М., Пенжорн Б.Л., Каррено, РА. Babesia conradae , sp. nov., небольшая собака Babesia , обнаруженная в Калифорнии.Vet Parasitol. 2006; 138: 103–11.

    Артикул Google ученый

  • 54.

    Холман П.Дж. Сравнительное исследование изолятов cervid Babesia . Диссертация по ветеринарной патобиологии, Техасский университет A&M, Колледж-Стейшн, Техас, США; 1994.

  • 55.

    Кьемтруп А.М., Томфорд Дж., Робинсон Т., Конрад П.А. Филогенетические взаимоотношения изолятов пироплазмы человека и диких животных на западе США, выведенные из гена малой субъединицы ядерной РНК 18S .Паразитология. 2000; 120: 487–93.

    CAS Статья Google ученый

  • 56.

    Criado-Fornelio A, Gonzalez-del-Rio MA, Buling-Sarana A, Barba-Carretero JC. Молекулярная характеристика изолята Babesia gibsoni от испанской собаки. Vet Parasitol. 2003; 117: 123–9.

    CAS Статья Google ученый

  • 57.

    Сайто-Ито А, Дантракул А, Кавай А, Сиота Т.Обследование грызунов и клещей в зоне появления бабезиоза человека в Японии: первое обнаружение Babesia microti -подобных паразитов в Ixodes ovatus . J Clin Microbiol. 2004; 42: 2268–70.

    Артикул Google ученый

  • 58.

    Захлер М., Риндер Х., Готе Р. Генотипический статус Babesia microti в пироплазмах. Parasitol Res. 2000. 86: 642–6.

    CAS Статья Google ученый

  • 59.

    Cornillot E, Hadj-Kaddour K, Dassouli A, Noel B, Ranwez V, Vacherie B и др. Секвенирование наименьшего апикомплексного генома патогена человека Babesia microti . Nucl Acids Res. 2012; 40: 9102–14.

    CAS Статья Google ученый

  • 60.

    Holman PJ, Madeley J, Craig TM, Allsopp BA, Allsopp MT, Petrini KR, et al. Антигенные, фенотипические и молекулярные характеристики подтверждают Babesia odocoilei , выделенную из трех цервид.J Wildl Dis. 2000; 36: 518–30.

    CAS Статья Google ученый

  • 61.

    Эллис Дж., Хеффорд С., Баверсток ПР, Далримпл Б.П., Джонсон А.М. Сравнение последовательностей рибосомной ДНК Babesia и Theileria . Мол Биохим Паразитол. 1992; 54: 87–95.

    CAS Статья Google ученый

  • 62.

    Оямада М., Даву Б., Бони М., Дерере Дж., Бучетон Б., Хаммад А. и др.Обнаружение Babesia canis rossi , B. canis vogeli и Hepatozoon canis у собак в деревне на востоке Судана с использованием скрининговых ПЦР и методологий секвенирования. Clin Diagn Lab Immunol. 2005; 12: 1343–6.

    CAS PubMed PubMed Central Google ученый

  • 63.

    МакДермид К.Р., Снайман А., Веррейнн Ф.Дж., Кэрролл Дж. П., Пенжорн Б.Л., Ябсли М.Дж. Надзор за вирусными и паразитарными патогенами в уязвимой популяции африканского льва ( Panthera leo ) в северном заповеднике Тули, Ботсвана.J Wildl Dis. 2017; 53: 54–61.

    CAS Статья Google ученый

  • 64.

    Sun Y, Li SG, Jiang JF, Wang X, Zhang Y, Wang H, et al. Babesia venatorum Инфекция у ребенка, Китай. Emerg Infect Dis. 2014; 20: 896–7.

    Артикул Google ученый

  • 65.

    Ciancio A, Scippa S, Finetti-Sialer M, De Candia A, Avallone B, De Vincentiis M. Повторное описание Cardiosporidium cionae (Van Gaver and Stephan, 1907) (Apicomplexa: Piroplasmida), плазмодород. паразит асцидиевых гемоцитов.Eur J Protistol. 2008. 44: 181–96.

    CAS Статья Google ученый

  • Babesia lengau, ассоциированная с церебральным и гемолитическим бабезиозом у двух домашних кошек Научно-исследовательская работа по теме «Ветеринария»

    fvl Parasites LU & Vectors

    КРАТКИЙ ОТЧЕТ Открытый доступ

    Babesia lengau, ассоциированная с церебральным и гемолитическим бабезиозом у двух домашних кошек

    Анна-Мари Босман1, Маринда К. Остхейзен1, Эстель Х. Вентер1, Йохан К.А. Стейл2, Тертиус А. Гоус3 и Баренд Л. Пенжорн1 *

    Аннотация

    Предыстория: хотя сообщения о бабезиозе из разных стран время от времени поступают спорадически, кошачий бабезиоз, по-видимому, является значительным клиническим проявлением только в Южной Африке, где Babesia felis обычно инкриминируется как возбудитель.Babesia lengau, недавно описанная у бессимптомных гепардов, теперь, возможно, инкриминирована как возбудитель в двух тяжелых клинических случаях у домашних кошек.

    Выводы: Обе кошки были подвергнуты экстремистской эвтаназии. В то время как типичный бабезиоз кошек в Южной Африке является афебрильным заболеванием с хроническим проявлением, у обеих кошек было острое начало серьезных клинических признаков, и температура их тела была выше нормального диапазона, когда они были представлены для лечения.Гемолитическая анемия подтверждена в одном случае. Насколько нам известно, это первое сообщение о церебральном бабезиозе у кошек. На блоттинге обратной линии продукты ПЦР 18S рДНК, полученные от обеих кошек, показали положительные профили гибридизации с видоспецифическим зондом B. lengau. Полученные две частичные последовательности гена 18S рРНК паразита показали высокое сходство последовательностей (99,9%) с B. lengau. В репрезентативном дереве, построенном методом объединения соседей с использованием двухпараметрической модели Кимуры, два получили частичные последовательности 18S рДНК и последовательность B.lengau сформировал монофилетическую группу с B. conradae и последовательностями, ранее изолированными от людей и диких животных на западе США.

    Заключение: Все клинические случаи бабезиоза кошек в Южной Африке не обязательно вызваны B. felis. Другие пироплазмы, например B. lengau может быть инкриминировано в клинических случаях, особенно в тех, которые происходят за пределами известной эндемичной области.

    Ключевые слова: Babesia lengau, церебральный бабезиоз, кошачий бабезиоз, гемолитическая анемия

    Выводы

    О бабезиозе домашних кошек спорадически сообщалось из различных стран, включая Францию ​​[1], Германию [2], Индию [3], Израиль [4], Польшу [5], Португалию [6], Таиланд [7] и Зимбабве. [8], но, по-видимому, представляет собой значительную клиническую единицу только в Южной Африке, где встречается в основном вдоль восточного и южного побережья (провинции Квазулу-Натал, Восточный и Западный Кейп), а также в отдельных очагах вдоль восточного откоса Мпумаланги. и провинции Лимпопо [9-11] (рис. 1).Это предполагает, что вектор (-ы) встречается (-и) только в этих областях, но вектор (-ы) остаются неизвестными. Клинические случаи, происходящие внутри страны, например: в провинции Гаутенг обычно относятся к взятым домашним животным

    * Для переписки: [email protected]

    Кафедра ветеринарных тропических болезней, Факультет ветеринарных наук, Университет Претории, Private Bag X04, Ондерстепорт 0110, Южная Африка Полный список информации об авторах доступен в конце статьи

    Bio Med Central

    , когда владельцы посетили побережье [9,12].Бабезиоз кошек хорошо известен в Южной Африке. Помимо сообщений о случаях [13], были проведены подробные исследования сигналов, клинических проявлений и патологии [9,14,15], а также лечения [12,16]. Обычно возникают летаргия, анорексия и анемия, а желтуха — лишь изредка [14]. Повышенная температура тела не является признаком этого заболевания [14]. В клинических случаях паразитемия обычно высока и может превышать 50% [14].

    Babesia felis, пироплазма, обычно вызывающая бабезиоз кошек в Южной Африке, была первоначально описана у суданской дикой кошки (Felis ocreata, син.F. sylvestris) [17]. Четырнадцать домашних кошек, зараженных кровью дикой кошки, стали стойко инфицированными с паразитемией <1%, но не развивали никаких клинических признаков [17]. Когда несколько лет спустя кошачий бабезиоз был впервые описан в Южной Африке, паразитом считалось

    .

    © 2013 Bosman et al .; лицензиат BioMed Central Ltd. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http: // creativecommons.Org / licenses / by / 2.0), что разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

    Рис. 1 Карта Южной Африки, показывающая местонахождение двух случаев. Эндемичный район бабезиоза кошачьих простирается вдоль восточного и южного побережья (провинции Квазулу-Натал, Восточный и Западный Кейп), а также вдоль восточного откоса в провинциях Мпумаланга и Лимпопо в северо-восточной части страны. Случай 1 (Рустенбург): Открытый круг.Уход 2 (Веллингтон): черный круг.

    морфологически похож на B. felis, но из-за патогенности у домашних кошек получил название Nuttallia felis var. domestica [13]. Остается неясным, действительно ли патогенный паразит в Южной Африке является созидательным с паразитом, описанным в Судане [17].

    Хотя сообщалось, что известная кенийская львица Эльза умерла от бабезиоза [18], Babesia felis sensu stricto не обвинялась в том, что вызывала болезни у кошачьих, кроме домашних кошек.Об этом сообщалось от 18 из 97 клинически здоровых гепардов в неволе (Acinonyx jubatus) в Южной Африке и 3 из 40 гепардов, обитающих на свободном выгуле в Намибии, а также от одного льва (Panthera leo) и сервала (Leptailurus serval) в Южная Африка [19]. Babesia leo, обычно обнаруживаемая у львов в Южной Африке, также была обнаружена у клинически здоровой домашней кошки [19,20].

    Недавно Babesia lengau была описана у клинически здоровых гепардов [21]. В этом ретроспективном исследовании мы сообщаем о двух тяжелых клинических случаях бабезиоза кошек у домашних кошек, связанных с B.lengau инфекция. Насколько нам удалось выяснить, это первое сообщение о церебральном бабезиозе у домашней кошки. В обоих случаях, которые произошли до официального описания B. lengau, у нас не было доступа к клиническим случаям, но мы интерпретировали отчеты о вскрытии. Обе кошки были подвергнуты экстремистской эвтаназии. Один случай был отправлен для вскрытия трупа и диагностики на основе нуклеиновых кислот на факультет ветеринарных наук, Ондерстепорт, Южная Африка. Образцы крови из

    Для подтверждения бабезиоза было подано

    случая.Эти два случая произошли в разных частях Южной Африки (Северо-Западная провинция и Западно-Капская провинция, последняя в пределах известной эндемичной области бабезиоза кошек), и между ними не было никакой связи. Результаты показали наличие паразита Babesia, очень близкого или похожего на B. lengau, недавно описанного у бессимптомных гепардов.

    Дело 1 (Рустенбург, Северо-Западная провинция; июнь 2004 года)

    Целый двухлетний сиамский кот, который ел и играл утром, в тот вечер был доставлен в ветеринарную клинику в обморочном состоянии.Температура 40,3 ° С, слизистые бледно-желтушные. В мазках крови обнаружены внутриэритроцитарные простейшие паразиты, морфологически напоминающие виды Babesia, а также эритроциты, фагоцитируемые лейкоцитами. Кошка была подвергнута эвтаназии, а замороженная тушка была отправлена ​​на вскрытие в отделение патологии факультета ветеринарных наук Университета Претории.

    Макроскопические результаты были следующими: Общее состояние тела животного было очень хорошим. При внешнем осмотре выявлено умеренное заражение блохами и выраженная желтушность слизистых оболочек.На теле животного клещей не обнаружено. При потрохивании наблюдалась выраженная желтуха, связанная с водянистой кровью (что свидетельствует о тяжелой анемии) на разрезе кровеносного сосуда. Первоначально анемия маскировалась тяжелой желтухой. Легкий гидроторакс и

    Наблюдались

    гидроперикард, а также острый центрилобулярный гепатоз. Возникла умеренная диффузная спленомегалия из-за гиперплазии красной пульпы и умеренный диффузный застой легких и отек. При цитологическом исследовании мазок-слепок селезенки показал многочисленные свободно лежащие группы / агрегаты сферических пироплазмоподобных простейших организмов среди лейкоцитов и литических эритроцитов.Иногда интактные эритроциты содержали один и тот же организм, напоминающий виды Babesia или Theileria. Артефакты замораживания могли повлиять на морфологию паразитов.

    Гистопатологический вывод заключался в том, что это животное страдало тяжелой предпеченочной желтухой и анемией, которые, по-видимому, возникли в результате сочетания внутри- и внесосудистого гемолиза. Замораживание артефактов отрицательно сказалось на изучении и интерпретации.

    Дело 2 (Веллингтон, Западно-Капская провинция; июль 2007 года)

    Домашняя короткошерстная кошка в возрасте 18 месяцев была доставлена ​​частному ветеринару с жалобой на слабость.Он был в хорошем состоянии, имел температуру 40,2 ° C и обнаружил анизокорию. Была небольшая хромота левой задней конечности, которая, по всей видимости, была связана с жесткостью разгибателей. Была сильная анемия и желтуха, и кошка была покрыта большим количеством клещей. В мазке крови обнаружено большое количество лейкоцитов в результате лимфоцитоза, но лечащий ветеринар не обнаружил паразитов крови. Мазок также показал признаки нерегенеративной анемии. Лечение состояло из внутривенных вливаний (лактата Рингера) и инъекций 0.3 мл дексаметазона, 0,4 мл амоксициллина и клавулановой кислоты (Synulox) и 0,4 мл комплекса витаминов B. У кошки действительно был аппетит, но ее кормили насильно. Вечером у кошки возникли нервные симптомы, такие как гребля, вокализация и спазмы шеи, и кошке стало легче внутривенно ввести передозировку барбитуратов.

    Вскрытие трупа выполнено частным патологоанатомом. Туша была в довольно хорошем состоянии. Отмечалась анемия, желтуха.Весь мозг показал очень выраженную гиперемию с четким красно-розовым изменением цвета серого вещества, а также многоочаговые петехии (рис. 2). Была сильная заложенность и отек легких. В перикарде умеренное количество серозно-геморрагической жидкости. Отмечена умеренная гиперемия селезенки, брыжеечных лимфатических узлов и поджелудочной железы.

    Исследование мазков крови патологом выявило умеренную паразитемию трофозоитов пироплазмы в эритроцитах, но мазки головного мозга показали большое количество пироплазм внутри и вне эритроцитов (рис. 3).Капилляры головного мозга были заполнены сильно паразитированными эритроцитами, что привело к образованию отложений. Поражения и паразиты в головном мозге были подтверждены гистопатологически.

    Рис. 2 Мозг кошки (Случай 2): Весь мозг показывает выраженную гиперемию с четким красно-розовым изменением цвета серого вещества, а также многоочаговые петехии (Фотография: Tertius Gous).

    Подтверждение наличия ДНК паразита с помощью частичного секвенирования гена 18S рРНК и филогенетического анализа

    ДНК было выделено из 0.2 г объединенных селезенки и лимфатического узла из случая 1 (BF226) и 0,2 г ткани мозга из случая 2 (BF463) с использованием коммерчески доступного мини-набора QIAamp® DNA (Qiagen, Whitehead Scientific, Южная Африка), в соответствии с инструкциями производителя . Гипервариабельная область V4 гена паразитической 18S рРНК была амплифицирована и подвергнута скринингу с использованием метода гибридизации с блоттингом обратной линии (RLB) [22,23]. Затем продукты ПЦР секвенировали (Inqaba Biotechnical Industries (Pty) Ltd, Претория, Южная Африка) с использованием праймеров RLB-F и RLB-R [23].

    Рис. 3 Мазок головного мозга (окраска Diff Quick) (Случай 2): слизь в капиллярах головного мозга эритроцитов, которые сильно паразитированы большой бабезией (x1000) Темные пурпурно-голубоватые пятна на фотографии представляют паразита в эритроците. (Фотография: Тертиус Гоус).

    Полученные данные о последовательностях были собраны и отредактированы с помощью GAP 4 пакета Staden (версия 1.6.0 для Windows) [24]. Поиск гомологичных последовательностей проводили с помощью BLASTn (www.ncbi.nlm.nih.gov) и последовательности близкородственных видов Babesia были сопоставлены с полученными последовательностями паразитов с помощью ClustalX (версия 1.81 для Windows). Выравнивание вручную усекали до размера наименьшей последовательности (405 п.н.). Филогенетическое дерево было построено с использованием метода объединения соседей [25] в сочетании с методом boot-strap (1000 повторов / дерево) [26]. Дерево консенсуса редактировалось с помощью MEGA v4.0.2 [27].

    Результаты обратного блоттинга для случая 1 (BF226) и случая 2 (BF463) показали положительные профили гибридизации с видоспецифическим зондом Babesia lengau [21].Данные последовательности показали, что две полученные последовательности 18S рДНК (KC7

    и KC833036) (405 п.н.) были идентичными. Поиск BLASTn показал высокое сходство (99,9%) с B. lengau (номер доступа GQ411405 к gQ411417) [21]; он отличался от B. lengau одной делецией. Репрезентативное дерево, построенное методом объединения соседей с использованием двухпараметрической модели Кимуры [28], показано на рисунке 4. Случай 1 (BF226), Случай 2 (BF463) и B. lengau

    (GQ411417) образовал монофилетическую группу с B.conradae (AF158702, AF231350), B. duncani (HQ285838, HQ289870) и другие последовательности, ранее идентифицированные у людей и диких животных на западе США (AY027815, AY027816, AF158700, AF158701, AF158709) (Рисунок 4).

    Обсуждение

    Оба случая, описанные здесь, в некоторых отношениях отличались от обычных клинических признаков, связанных с бабезиозом кошек в Южной Африке [14]. Бабезиоз кошек обычно протекает без лихорадки, тогда как температура тела в обоих случаях была выше нормы, когда они поступили на лечение.Гемолитическая анемия, наблюдаемая в случае 1, обычно не связана с типичным кошачьим бабезиозом [14]. Организм, похожий на B. lengau, недавно был признан виновником гемолитической болезни у овец в Греции [29].

    До недавнего времени предполагалось, что все мелкие пироплазмы домашних кошек, морфологически напоминающие B. felis, принадлежат к этому виду. Теперь было продемонстрировано, что различные мелкие Babesia spp. может заразить домашних кошек [19]. Практикующие врачи обычно проводят микроскопическую идентификацию пироплазм в мазках крови для диагностики бабезиоза у кошек и других домашних животных.Подтверждающие виды

    Рис. 4 Результаты анализа соединения гена 18S рРНК двух пироплазм: показано филогенетическое родство пироплазм, участвующих в случаях 1 и 2, с другими видами Babesia и Theileria. Масштабная линейка представляет% нуклеотидных различий.

    Однако идентификация

    часто требует инструментов молекулярной диагностики. Блот-анализ с обратной линией и филогенетический анализ также более чувствительны, чем анализ мазка крови, для демонстрации присутствия Babesia spp.у субклинически инфицированных животных.

    Макроскопические и гистопатологические результаты обоих описанных здесь случаев свидетельствуют о тяжелом заболевании, вызванном инфицированием паразитом Babesia, как описано для собак [30]. Методы молекулярной диагностики подтвердили наличие паразитов бабезии в мазках крови и головного мозга. Филогенетический анализ выявил высокое сходство с B. lengau.

    Babesia lengau была описана у бессимптомных гепардов [21], и на сегодняшний день не существует доказательств того, что B.lengau вызывает клиническое заболевание у этого хозяина. Единственная другая пироплазма, с которой генотипически связана B. lengau, — это собачий паразит B. conradae, который был описан у собак в Калифорнии, США, и ассоциирован с гемолитической анемией у хозяина [31,32]. Babesia lengau и B. conradae являются частью ранее описанной «западной клады» пироплазм, которая также включает B. duncani и пироплазмы, выделенные как у людей, так и у диких животных на западе США. Он сгруппирован отдельно от Babesia sensu stricto, B.microti clade и виды Theileria и Cytauxzoon.

    Церебральный бабезиоз часто встречается у крупного рогатого скота (например, вызывается B. bovis) [33] и собак (например, вызывается B. rossi) [34,35]. Насколько нам известно, это первое сообщение о церебральном бабезиозе у домашней кошки.

    Заключение

    Все клинические случаи бабезиоза кошек в Южной Африке не обязательно вызваны B. felis. Другие виды бабезии, например Б.lengau, могут быть инкриминированы клинические случаи, особенно те, которые происходят за пределами известной эндемичной области. Как правило, идентичность вовлеченных видов бабезий в идеале должна подтверждаться молекулярными методами при отправке образцов от случаев подозрения на бабезиоз кошек в диагностические лаборатории. Также рекомендуется исследование мазков или срезов головного мозга. Поскольку переносчик B. felis еще не подтвержден, наши результаты подчеркивают безотлагательность дальнейших исследований для улучшения понимания эпидемиологии этого загадочного заболевания.

    Конкурирующие интересы

    Авторы заявляют об отсутствии конкурирующих интересов. Вклад авторов

    AMB провел молекулярно-генетические исследования, участвовал в выравнивании последовательностей и написал первый черновик рукописи; MCO контролировал лабораторные работы и участвовал в выравнивании последовательностей и построении филогенетических деревьев; EHV совместно руководила лабораторной работой; JCAS и TAG выполнили вскрытие и гистологическое диагностическое исследование случаев 1 и 2 соответственно; BLP координировала расследование, проводила поиск литературы и написала окончательную версию отчета.Все авторы прочитали и одобрили окончательный вариант рукописи.

    Благодарности

    Мы благодарим доктора Т.А. Schouwstra (Рустенбург) и Dr Marisa Naude (Кейптаун) за передачу дел. Это исследование финансировалось за счет гранта Южноафриканского национального исследовательского фонда (грант NRF GUN 2069496), предоставленного Б.Л. Пенжорну. Публикация тематической серии CVBD8 спонсировалась Bayer Animal Health GmbH.

    Сведения об авторе

    Кафедра ветеринарных тропических болезней, Факультет ветеринарных наук, Университет Претории, Private Bag X04, Ондерстепорт 0110, Южная Африка.2 Кафедра параклинических наук, факультет ветеринарных наук, Университет Претории, Private Bag X04, Ондерстепорт 0110, Южная Африка. Патологоанатом-ветеринарный врач, П.О. Box 5371, Helderberg 7135, Южная Африка.

    Получено: 30 января 2013 г. Принято: 23 апреля 2013 г. Опубликовано: 1 мая 2013 г.

    Список литературы

    1. Bourdeau P: Кошачий бабезиоз. Поинт Вет 1996, 27: 947-953.

    2. Мойк К., Гот Р: Инфекции кошачьих бабезией и отчет о случае кошки в Германии.Tierärztl Praxis 1997, 25: 532-535.

    3. Мангрулкар М.Ю.: На пироплазме индийской кошки (Felis domesticus). Ind J Vet Sci Anim Husb 1937, 7: 243-246.

    4. Банет Дж., Кенни М.Дж., Таскер С., Ануг Ю., Шкап В., Леви А., Шоу С.Е .: Заражение домашних кошек предложенным новым подвидом Babesia canis, Babesia canis subsp presentii. J Clin Microbiol 2004, 42: 99-105.

    5. Adaszek L, Winiarczyk S, Lukaszewska J, Heile C: Babesiose bei einer Katze (кошачий бабезиоз).Kleintierpraxis 2010, 55: 624-628.

    6. Вильена Х., Мартинес-Диас В.Л., Кардосо Л., Виейра Л., Альтет Л., Франсино О., Пастор Дж., Сильвестре-Феррейра А.С.: переносимые кошками патогены-переносчики на севере и в центре Португалии. Паразиты и переносчики 2013,6: 99. DOI: 10.1186 / 1756-3305-6-99.

    7. Джиттапалапонг С., Джансаван В. Предварительное исследование паразитов крови кошек в районе Бангкен. Kasetsart J Nat Sci 1993, 27: 330-335.

    8.Стюарт CG, Hackett KJW, Collett MC: Неопознанная бабезия домашней кошки (Felis domesticus). J S. Afr Vet Assoc 1980, 51: 219-221.

    9. Якобсон Л.С., Шуман Т., Лобетти Р.Г .: Обзор кошачьих бабезиозов в Южной Африке. J S Afr Vet Ass 2000, 71: 222-228.

    10. Penzhorn BL, Schoeman T, Jacobson LS: Кошачий бабезиоз в Южной Африке: обзор. Ann NY Acad Sci 2004, 1026: 183-186.

    11. Penzhorn BL, Stylianides E, Coetzee MA, Viljoen JM, Lewis BD: Очаг кошачьего бабезиоза в Kaapschehoop на откосе Mpumalanga.J S Afr Vet Assoc 1999, 70:60.

    12. Potgieter FT: Химиотерапия инфекции Babesia felis: эффективность некоторых лекарств. J S. Afr Vet Assoc 1981, 52: 289-293.

    13. Джексон К., Даннинг Ф. Дж .: Желчная лихорадка (нутталиоз) кошек: случай в районе Стелленбош. J S Afr Vet Med Assoc 1937, 8: 83-87.

    14. Futter GJ, Belonje PC: Исследования бабезиоза кошек. 2. Клинические наблюдения. J S. Afr Vet Assoc 1980, 51: 143-146.

    15.Шеман Т., Лобетти Р.Г., Якобсон Л.С., Пенжорн Б.Л.: Бабезиоз кошек: сигналы, клиническая патология и сопутствующие инфекции. J S Afr Vet Assoc 2001, 72: 4-11.

    16. Penzhorn BL, Lewis B, Lopez-Rebollar LM, Swan GE: Скрининг пяти препаратов на эффективность против Babesia felis у экспериментально инфицированных кошек. J S Afr Vet Assoc 2000, 71: 53-57.

    17. Дэвис Л.Дж .: О пироплазме суданской дикой кошки (Felis ocreata). Trans R Soc Trop Med Hyg 1929, 22: 523-534.

    18. Барнетт С.Ф., Броклсби Д.В.: Некоторые пироплазмы диких млекопитающих. Symp Zool Soc Lond 1968, 24: 159-176.

    19. Босман А.М., Вентер Э.Х., Пенжорн Б.Л.: Встречаемость Babesia felis и Babesia leo у различных диких кошачьих и домашних кошек в Южной Африке, на основе анализа блоттинга обратной линии. Vet Parasitol 2007, 144: 33-38.

    20. Penzhorn BL, Kjemtrup AM, Lopez-Rebollar LM, Conrad PA: Babesia leo n. sp. от львов в Национальном парке Крюгера, Южная Африка, и его связь с другими небольшими пироплазмами.J Parasitol 2001, 87: 681-685.

    21. Bosman AM, Oosthuizen EC, Peirce MA, Venter EH, Penzhorn BL: Babesia lengau sp. nov., новый вид бабезии в популяциях гепарда (Acinonyx jubatus, Schreber, 1775) в Южной Африке. J Clin Microbiol 2010, 48: 2703-2708.

    22. Gubbels JM, de Vos AP, van der Weide M, Viseras J, Schouls LM, de Vries E, Jongejan F: одновременное обнаружение бычьих видов Theileria и Babesia с помощью блот-гибридизации с обратной линией.J Clin Microbiol 1999, 37: 1782-1789.

    23. Nijhof A, Pillay V, Steyl J, Prozesky L, Stoltsz WH, Lawrence JA, Penzhorn BL, Jongejan F: Молекулярная характеристика видов Theileria, связанных со смертностью у четырех видов африканских антилоп. J Clin Microbiol 2005, 43: 5907-5911.

    24. Стаден Р., Бил К. Ф., Бонфилд Дж. К.: Пакет Staden, 1998. Методы Mol Biol 2000, 132: 115-130.

    25. Saitou N, Nei M: Метод объединения соседей: новый метод реконструкции филогенетических деревьев.Mol Biol Evol 1987, 4: 406-425.

    26. Felsenstein J: Пределы уверенности в филогении: подход, использующий бутстрап. Evolution 1985, 39: 783-791.

    27. Тамура К., Дадли Дж, Ней М., Кумар С: MEGA4: программа молекулярно-эволюционного генетического анализа (MEGA), версия 4.0. Mol Biol Evol 2007, 24: 1596-1599.

    28. Кимура М: простой метод оценки скорости эволюции замен оснований с помощью сравнительных исследований нуклеотидных последовательностей.Дж Мол

    Evol 1980, 16: 111-120.

    29. Гиадинис Н.Д., Чочлакис Д., Крицепи-Константину М., Макридаки Э., Целентис Й., Костопулу Д., Карациас Н., Псарулаки А. Гемолитическая болезнь овец, приписываемая организму, подобному Babesia lengau. Vet Rec 2012, 170: 155b. DOI: 10.1136 / vr.100394.

    30. Бузер А.Л., МакИнтайр ДК: Бабезиоз собак. Vet Clin N Am Small Anim Pract 2003, 33: 885-904.

    31. Конрад П.А., Томфорд Дж.В., Марш А., Телфорд С.Р. III, Андерсон Дж. Ф., Спилман А., Сабин Е.А., Яман Л., Персинг Д.Х. Гемолитическая анемия, вызванная инфекцией Babesia gibsoni у собак.J Am Vet Med Assoc 1991,199: 601-605.

    32. Кьемтруп А.М., Уэйнрайт К., Миллер М., Пенжорн Б.Л., Каррено РА: Babesia conradae, sp. nov., небольшая собачья бабезия, обнаруженная в Калифорнии. Vet Parasitol 2006, 138: 103-111.

    33. Невилс М.А., Фигероа СП, Тюрк Дж. Р., Канто Дж. Дж., Ле В., Эллерсик М.Р., Карсон К.А.: Клонированные линии Babesia bovis различаются по своей способности вызывать церебральный бабезиоз у крупного рогатого скота. Parasitol Res 2000, 86: 437-443.

    34.Якобсон Л.С.: Южноафриканская форма тяжелого и сложного бабезиоза собак: клинические достижения 1994-2004 гг. Vet Parasitol 2006, 138: 126-139.

    35. Malherbe WD, Parkin BS: Атипичная симптоматика инфекции Babesia canis. J S Afr Vet Med Assoc 1951, 22: 25-36.

    DOI: 10.1186 / 1756-3305-6-128

    Процитируйте эту статью как: Bosman et al .: Babesia lengau ассоциируется с церебральным и гемолитическим бабезиозом у двух домашних кошек.Паразиты и векторы 2013 6: 128.

    Отправьте следующую рукопись в BioMed Central и воспользуйтесь всеми преимуществами:

    • Удобная онлайн-подача

    • Тщательная экспертная оценка

    • Отсутствие ограниченного пространства или платы за цветные рисунки

    • Немедленная публикация о приемке

    • Включение в PubMed, CAS, Scopus и Google Scholar

    • Исследование, свободно распространяемое

    Отправьте рукопись на Tpntral

    www.biomedcentral.com/submit> _ciiuai

    Клинико-патологические результаты и ведение пациентов

    Ретроспективный и проспективный анализ историй болезни собак с диагнозом инфекций Babesia был проведен за период с 2000 по 2013 год на базе практик в Лусаке, Замбия. Записи о 363 собаках с подтвержденными инфекциями Babesia были проанализированы с использованием демографических факторов, включая пол, породу, возраст и клинические признаки в отношении гематологических результатов и видов Babesia .Описаны наблюдаемые клинические и лабораторные данные, а также идентификация Babesia видов. В исследование были включены 18 пород, наибольшая доля составляли дворняги (32,2%), самцы составляли 64,5% популяции. Наиболее частыми проблемами были анорексия (65,3%) и летаргия / слабость (65,3%). Наиболее частыми клиническими признаками были лихорадка (87,3%), бледность (52,3%), лимфаденопатия (47,4%) и наличие клещей (44,9%). Анемия (96,4%) и ядросодержащие эритроциты (42,2%) были наиболее частыми лабораторными находками.Смешанная инфекция Babesia rossi и Babesia gibsoni присутствовала у 59,7% собак, в то время как у 8% и 32,2% собак было инфицировано B. rossi и B. gibsoni соответственно. Ведение случая в основном включало терапию тетрациклинами и имидокарбом и обычно сопровождалось клиническим улучшением. В этом исследовании впервые подчеркивается присутствие B. gibsoni в естественных популяциях собак в Замбии, где ранее только B.rossi поступило сообщение.

    1. Введение

    Бабезиоз — клещевое заболевание, вызываемое простейшими из рода Babesia , распространенное во всем мире [1, 2]. Бабезиоз собак — важное заболевание домашних и диких Canidae [3]. Babesia — интраэритроцитарные трансмиссивные организмы с многочисленными видами собак Babesia , о которых сообщается в мире, а именно: Babesia canis , Babesia rossi , Babesia vogeli , Babesia gibsoni и microbabesia microbabesiae , Babesia vulpes sp. ноя и Babesia conradae [4–6]. В Африке зарегистрированы Babesia canis , B. rossi , B. vogeli и B. gibsoni , без каких-либо сообщений о микробабезиях [4, 7]. Babesia rossi встречается только в Африке [7]. Также существует один, пока еще безымянный вид Babesia , обнаруженный в Северной Америке [4, 7].

    Наиболее частыми клиническими признаками, связанными с бабезиозом, являются анорексия, лихорадка, депрессия / летаргия, бледность слизистых оболочек, спленомегалия и потеря веса [8–11].Клинические проявления бабезиоза собак различаются в зависимости от географического региона и вовлечены бабезий и видов [4, 5, 12, 13]. Сообщалось также о необычных клинических проявлениях бабезиоза собак, которые включают симптомы, связанные с центральной нервной системой, такие как судороги [14, 15]. В Африке опубликованные данные о бабезиозе собак ограничены, а в Южной Африке и Нигерии опубликованных данных еще меньше [16]. Существует множество факторов, влияющих на распространенность бабезиоза собак, и исследования с B.canis показали, что более склонны чистокровные собаки, животные в возрасте до одного года и собаки, которые ранее страдали бабезиозом или не получали профилактического лечения эктопаразитов [17]. Происходит совместное инфицирование Babesia другими трансмиссивными болезнями собак [16] и часто приводит к атипичным клиническим признакам и проявлениям [18, 19].

    Клинико-патологические картины в случаях бабезии случаев включают регенеративную анемию, тромбоцитопению и лейкопению (нейтропения и лимфопения) вначале после инфицирования, вскоре за которыми следуют лейкоцитоз и нейтрофилия со сдвигом влево через несколько дней после заражения [20].Хронические случаи бабезиоза собак, как правило, имеют более неясные клинические признаки. Прогностические факторы инфекции Babesia у собак включают концентрацию лактата в крови и PCV [21]. Предполагается, что Babesia rossi имеет полиморфный фосфопротеин, названный геном мембранного антигена 1 эритроцитов Babesia rossi ( BrEMA1 ), который может быть ответственным за вирулентность [16]. Это может объяснить некоторые различия в клинических проявлениях у собак, инфицированных этим видом.

    Существует ряд терапевтических возможностей для лечения бабезиоза собак. Дипропионат имидокарба, ацетурат диминазена, клиндамицин [7, 22] и доксициклин [23] являются эффективными. Переливание крови улучшает клинический результат терапии [24]. Однако в случаях заражения малыми видами бабезий клиническое и паразитологическое излечение часто не достигается, и часто регистрируются рецидивы [7]. Обычно назначается поддерживающая терапия, которая включает инфузионную терапию, противовоспалительные и жаропонижающие средства [20], гастропротекторы, кислородные добавки и переливание крови [22].При экспериментальной инфекции Babesia клиническое выздоровление было показано только при поддерживающем лечении [20], что подчеркивает важность этого аспекта ведения случая.

    Контроль включает использование акарицидов местного применения [25] для устранения клещевого переносчика и может также включать новые методы, такие как ошейники, пропитанные акарицидом [26]. Профилактическое использование имидокарба при перемещении животных в эндемичные районы [10] также может осуществляться. Была разработана вакцинация против бабезиоза [27], которая индуцирует частичную защиту от заболевания за счет уменьшения выраженности клинических признаков, паразитемии или продолжительности клинического заболевания [7].Однако, как и в случае с вакцинацией, большинство текущих профилактических мер считаются недостаточными для полной защиты [5].

    В Замбии было проведено пилотное исследование для определения эпидемиологии инфекций собак Babesia в лабораторных образцах и естественных популяциях; исследование показало, что собака Babesia относится к крупному типу и имеет среднемесячную распространенность до 28,6% и 2,4%, соответственно, с двумя сезонными пиками в сезон дождей и прохладный сухой сезон [28].Недавнее молекулярное исследование диких животных и домашних собак в заповедниках Замбии обнаружило видов бабезий, видов у диких хищников, но не бабезий у домашних собак [29]. Несмотря на то, что знание клинико-патологических проявлений такого заболевания, как бабезиоз, имеет эпидемиологическое и медицинское значение [7], нет опубликованной литературы о клинико-патологическом проявлении Babesia у собак в Центральной Африке. Целью этого последующего исследования было документирование клинических признаков, гематологических профилей, молекулярного видообразования и вариантов ведения случаев при естественном бабезиозе собак в Замбии.

    2. Материалы и методы
    2.1. Критерии включения

    Проведено смешанное, ретроспективное и проспективное исследование клинических случаев бабезиоза. Случаи были легко отобраны, и критериями включения были собаки с полными, хорошо задокументированными медицинскими записями, те, которые дали положительный результат на Babesia при исследовании мазка крови и имели полный гематологический профиль. В этом исследовании учитывались клинические записи из ветеринарной клиники, школы ветеринарной медицины Университета Замбии и двух частных ветеринарных клиник в Лусаке для собак, которые соответствовали критериям включения.Собаки, у которых были другие диагностированные сопутствующие заболевания или не полностью задокументированные медицинские записи, были исключены из исследования.

    2.2. Подбор кейсов
    2.2.1. Ретроспектива

    Были изучены истории болезни собак с диагнозом Babesia с 2000 по 2009 год. Информация о сигналах, представлении проблемы, клинических признаках, гематологических данных, схемах ведения / лечения и исходах случаев была задокументирована. Данные из истории болезни были введены в форму для сбора данных.

    2.2.2. Prospective

    Проспективное исследование проводилось с марта 2009 г. по декабрь 2013 г. Ветеринарные врачи заполняли формы для сбора данных по всем случаям, которые имели клиническое подозрение на трансмиссивную болезнь собак, обычно диагностируемую как «клещевая лихорадка».

    2.2.3. Сбор крови и PCV

    Кровь, полученная путем пункции головной вены, была подвергнута лабораторному анализу, как описано ранее [28], и собаки были классифицированы как страдающие анемией на основании модификации критериев классификации Reyers et al.(1998), цитируется Якобсоном [14] в сочетании с работой Тведтена и Вайсса [30]. Собаки с PCV менее 15% считались тяжелой анемией, собаки с PCV 15–30 — средней анемией, собаки с PCV> 30–37 — легкой анемией, а собаки с PCV> 37% — неанемическими.

    В исследование были включены пациенты, у которых был положительный результат мазка крови и у которых был проведен полный гематологический анализ.

    Клещей также собирали у каждой собаки, помещали в простую пробирку для сыворотки объемом 10 мл с 70% этанолом и идентифицировали до родового уровня с помощью ключа Soulsby [31].

    2.3. Экстракция ДНК и семинизированная ПЦР

    Шестьдесят два Babesia -положительных случая из проспективного исследования имели кровь на картах Whatman FTA для последующего выделения ДНК и идентификации видов Babesia с помощью семенной ПЦР с использованием метода и праймеров, использованных Birkenheuer et al. al. [32].

    ДНК

    экстрагировали с использованием метода лизиса сапонина и хранили при -20 ° C до использования. ПЦР с полусодержанием проводили, как описано Birkenheuer et al.[32]. В ходе первичной ПЦР амплифицировали фрагмент длиной приблизительно 340 пар оснований (п.н.) из B. gibsoni (азиатский генотип) и B. rossi . Вторичная ПЦР с использованием специфических внутренних праймеров для B. gibsoni (азиатский генотип) (BgibAsia-F) и B. rossi (BCR-F) была спарена с внешним обратным праймером первичной ПЦР для амплификации 185 п.н. Ампликоны по 197 п.н. соответственно. Продукты ПЦР визуализировали в трансиллюминаторе после электрофореза в 1,5% агарозном геле, содержащем 0.2 μ г Зеленый Мидори.

    2.4. Обработка и анализ данных

    Данные были введены в электронную таблицу Microsoft Excel, проверены на правильность и импортированы в Minitab версии 14 для статистического анализа и построения графиков. Статистически значимые различия были определены как различия с. Непрерывные данные были проанализированы с использованием одностороннего дисперсионного анализа (ANOVA). Для парных сравнений использовали апостериорный тест множественного сравнения Тьюки. Для определения корреляции использовался тест корреляции Пирсона.Для определения разницы в пропорциях использовался критерий хи-квадрат.

    3. Результаты

    Из 412 историй болезни случаев, у которых был диагностирован положительный результат на Babesia при исследовании мазка крови, 363 были включены в исследование, удовлетворяющие критериям включения. Остальные были исключены из исследования в основном потому, что либо у них не было полного гематологического профиля и диагноз был поставлен только с помощью мазка крови, либо они не полностью заполнили историю болезни или формы сбора данных.

    3.1. Породы собак, возраст и гендерное распределение

    Были проанализированы записи 363 пациентов, и наиболее представленные породы собак были дворнягами (32,2%) и мальтийскими пуделями (16,3%), в то время как шарпей и бостон-терьер были наименее представлены (Таблица 1) . Были включены семнадцать различных экзотических чистых пород и два других класса (чистопородные помеси и местные породы / дворняги). Таким образом, экзотические собаки и их помеси вместе составили наибольшую долю собак с диагнозом Babesia (Таблица 1).Кобели составляли большинство (64,5%) испытуемых (рис. 1). Точный возраст был определен у 89% (323/363) собак с использованием регистрационной карты прививок и составлял от двух месяцев до восьми лет (средний возраст 18 месяцев). Как показано на Рисунке 1, собаки в возрасте от двух до пяти лет составили наибольшую долю (29,47%), за ними следуют собаки в возрастной группе от шести месяцев до одного года (22,11%). Собаки старше 5 лет были самой маленькой группой, включая одного кобеля старше 10 лет. Собаки, точный возраст которых не мог быть определен, классифицировались только как взрослые собаки.

    ston 909 909 909 909 909 909 909 909 909 Кокер-спаниель 909 30

    Порода Счетчик

    Бурбуль 16
    2
    Кроссбрид 43
    Доберман 8
    Немецкий дог 2
    GSD 909 909 909 909 909 909 909 29 909 909 29 909 909 909 Лабрадор 6
    Мальтийский пудель 59
    Мастиф 1
    Монгрел 117
    9029 9029 9029 9029 9029 Romeranian Ротвейлер 17
    шарпей 1
    стаффордширский терьер 2
    йоркширский терьер 3

    9029 9029 9029 9029 9029 9029 9029 9029 9029 9029 909 Гибридные собаки — это собаки, классифицируемые как таковые, потому что они имеют одну известную особую экзотическую породу, но скрещиваются с собакой другой породы.
    GSD: немецкая овчарка.

    3.2. Анамнез и результаты физикального обследования

    Различные клинические признаки и проблемы показаны на Рисунке 2. Основными проблемами, о которых сообщили владельцы, были анорексия (65,3%), депрессия / летаргия (65,3%) и потеря веса (20,4%). Наиболее частыми клиническими признаками были лихорадка (87,3%), бледность (52,3%) и лимфаденопатия (47,4%). Средняя ректальная температура составила 39,6 ° C (± SD, диапазон; ± 0,995, 34,7–41,7).Исследование также показало, что у 4,7% собак температура была ниже нормы (температура <37 ° C). Не было существенной разницы в ректальной температуре между собаками местной породы и экзотическими собаками (ANOVA:;; экзотическая средняя температура ± SD =, средняя температура дворняги ± SD =). Сорок пять процентов собак были заражены клещами, в основном из рода Rhipicephalus . Другие наблюдаемые клинические признаки / проблемы включали рвоту, спленомегалию, обезвоживание, желтуху и асцит. Два случая поступили с тяжелым носовым кровотечением.Только в одном случае наблюдались судороги с полиурией / полидипсией. Была обнаружена слабая положительная значимая корреляция между PCV и ректальной температурой тела (,).


    3.3. Лабораторные данные
    3.3.1. Идентификация паразитов

    Микроскопическое исследование подтвердило, что все собаки были инфицированы Babesia видов. ПЦР-реакция позволила дифференцировать B. gibsoni (азиатский генотип) как единичную инфекцию у 32,2% (20/62) и B.rossi как единичное заражение в 8% (5/62) проб. Большинство (37/62; 59,7%) других образцов имели смешанную инфекцию.

    3.3.2. Гематологические результаты

    В таблице 2 представлены гематологические результаты в образцах крови. Наиболее стойкими гематологическими отклонениями были анемия (96,4%), ядросодержащие эритроциты (42,2%) и гипохромазия (34,7%). Анемия была гипорегенеративной, нормоцитарной и нормохромной в 65,3% случаев (таблица 3). Общее среднее значение PCV составило 18,4% (± SD, диапазон; ± 9.2, 5,0–49,0), а общее среднее значение Hb составляло 6,4 г / л (± стандартное отклонение, диапазон; ± 3,04, 1–14,1). Тяжелая анемия наблюдалась у 55,1% собак, у 33% — умеренная анемия, у 8,0% — легкая анемия и у 3,6% — неанемия (рис. 3). Также не было различий в пропорциях собак с тяжелой анемией по возрастным классам (рис. 3). Однако только в возрастных группах от трех месяцев до двух лет было около собак с положительной реакцией на бабезию и собак без признаков анемии, тогда как в других возрастных группах все они были анемичными (рис. 3).Собаки с однократным инфицированием B. rossi имели более низкие уровни PCV и Hb, за ними следовали собаки с однократным инфицированием B. gibsoni . Собаки с одновременной инфекцией B. gibsoni и B. rossi имели более высокие уровни PCV и Hbs, чем собаки с единичной инфекцией того и другого, но различия не были значительными (ANOVA:;; B. rossi среднее значение PCV ± SD; B. gibsoni среднее значение PCV ± SD; смешанное инфицирование PCV ± SD) (Рисунок 4). Тромбоцитопения наблюдалась у 17.1% случаев. Статистических различий в PCV между беспородными и экзотическими породами и их помесями не было (ANOVA:;; экзотическое среднее PCV ± стандартное отклонение, среднее значение PCV ± стандартное отклонение).

    0,49 29 24,5

    Параметр Все Babesia -положительные (среднее ± стандартное отклонение) B. rossi (среднее ± стандартное отклонение) B. gibsoni (среднее ± SD) Смешанные (среднее ± стандартное отклонение) Контрольные значения [33]

    лейкоцитов × 10 3 / μ L 9.67 ± 7,46 17,17 ± 8,46 8,68 ± 3,78 9,04 ± 6,32 5,5–16,9
    Эритроциты × 10 6 / μ L 2,98 ± 1,50 2,92 ± 1,06 3,17 ± 1,40 5,5–8,5
    PCV (%) 18,37 ± 9,22 10,67 ± 1,53 16,11 ± 6,81 20,15 ± 9,94
    P / белок (г / дл) 7.15 ± 1,28 6,40 ± 0,20 5,90 ± 0,88 7,48 ± 1,20 5,4–7,7
    Гемо’ГБ (г / дл) 6,40 ± 3,05 4,07 ± 0,23 6,86 ± 3,33 12,0–18,0
    MCV (fL) 64,19 ± 13,34 62,73 ± 8,09 62,16 ± 4,55 63,51 ± 4,45 609 C () ) 35,94 ± 6,14 38.70 ± 6,85 33,44 ± 1,20 33,79 ± 1,28 31–37
    МСН (пг) 23,35 ± 5,30 24,67 ± 7,74 20.60 ± 1,999–1,999

    Дифференциальный подсчет лейкоцитов
    Группа нейтрофилов% 3,29 ± 4,8000 ± 1,73 1,80 ± 0,84 3,44 ± 2,31 0–3
    сег. нейтрофилов% 55,98 ± 13,24 58,0 ± 23,5 50,60 ± 20,34 55,12 ± 14,69 60–80
    Лимфоциты% 29,57 ± 11,45 20934 29,57 ± 11,45 20934 31,29 ± 12,70 10–34
    Эозинофилы% 4,26 ± 2,38 4,00 ± 1.00 4,20 ± 3,03 4,765 ± 1,52 2–10
    Моноцит% 6,73 ± 4,48 4,87 ± 3,74 6,65 ± 4,73 5,93 ± 4,129
    n 363 5 20 37

    RBC: эритроцит.
    909 9029 9029 9029 9029 9029 9029 Лаборатория 9029

    NRBC 154 42.42
    Анизоцитоз 79 21,76
    Зубчатые эритроциты 43 11,85
    Гипохромазия 9029 934 9349 9029 9029 9029 9029 9029 9029 9029 9029 9029 9029 9029 9029 9029 9029 9029 Тромбоцитопения 62 17,08
    Лимфоцитоз 79 21,76
    Моноцитоз 60 16.53
    Лейкопения 19 5,23
    Нейтрофилия 9 2,48

    клеток крови
    красный

    3.4. Ведение случая и исходы болезни

    Пациенты часто лечились инъекционными и пероральными препаратами, указанными в таблице 4. Имидокарб дипропионат вместе с доксициклином был наиболее часто используемым специфическим противопротозойным инъекционным лечением (51.0%), затем только доксициклин (24,0%) и только имидокарб дипропионат (5,5%), и только 0,8% (3/363) случаев лечились с помощью диминазена в качестве противовоспалительного средства (таблица 4). Примерно шестьдесят процентов (219/363) получали 10–21-дневный курс перорального доксициклина в дозе 10 мг / кг веса тела два раза в день.

    9023 60934933

    Лекарственный препарат %

    Инъекционный NS 68
    B-комплекс 152 41,87
    Переливание крови 7 1,93
    Дексаметазон 136 9029 9029 9029 9029 Дексаметазон 136 9029 9029 9029 9029 Дексаметазон Только доксициклин 87 23,97
    Доксициклин и имидокарб 185 50,96
    Только имидокарб 20 5.51
    Внутривенные (IV) жидкости 15 4,13
    Ивермектин 19 5,23
    Окситетрациклин (OTC)
    9029 9029 909 909 909 909 909 11 3,03
    Пероральные препараты
    B комплекс 173 47,66
    Доксициклин
    Преднизолон 25 6,89
    Сукральфат 8 2,20
    Омепразол 3

    паразол спрей

    24 6,61
    Точечный противопаразитарный 31 8,54
    Антипаразитарный промыватель / средство для мытья рук 42 11.57

    НПВП: нестероидные противовоспалительные препараты.

    Некоторым собакам давали дополнительное иммуносупрессивное лечение (всего 37,4% получали инъекции дексаметазона, 5,1% (20/363) получали инъекционный дексаметазон и пероральный преднизолон и 1,4% (5/363) получали только пероральный преднизолон). Другие методы лечения включали использование гастропротекторов (0,8% омепразола, 2,2% сукральфата). Переливания крови проводили в 1.9% (7/363) случаев, при этом шесть из семи случаев были госпитализированными. Примерно 27% (97/363) собак получали местное лечение эктопаразита, которое включало окунание (11,6%), точечное лечение (8,5%) и спреи (6,6%).

    Из собак с диагнозом бабезия 41,9% (152/363) были госпитализированы, остальные лечились амбулаторно. Госпитализация длилась в среднем несколько дней и варьировалась от преимущественно ночного наблюдения до максимум 21 дня. Не было значительной разницы в доле анемии и PCV у собак, которые были госпитализированы, и тех, которые не были госпитализированы (ANOVA:;; госпитализированное среднее PCV ± SD =, амбулаторное среднее PCV ± SD =).Госпитализированные собаки с большей вероятностью были теми, кому сделали переливание крови, чем амбулаторные больные (, и) с учетом оговорки о том, что в амбулаторной группе был только один случай переливания крови, что меньше, чем минимум пять, обычно рекомендуемых для Китая. квадратный тест.

    4. Обсуждение

    Настоящее исследование описывает клинические признаки и ведение случаев естественного бабезиоза в Замбии. Исследование представляет собой первое систематическое исследование клинико-патологических проявлений бабезиоза собак в этом регионе, а также впервые сообщает о виде Babesia , обнаруженном у домашних собак в Замбии, в сопоставлении с клинико-патологическими данными.В исследовании представлена ​​новая информация о клинико-патологических проявлениях бабезиоза собак и видов Babesia , а именно B. gibsoni и B. rossi . Хотя отсутствие положительных случаев у домашних собак в недавнем молекулярном исследовании в Замбии [29] можно объяснить региональными различиями между центральной частью Замбии и восточными и западными регионами, где проводилось недавнее исследование [29]. Вышеупомянутое исследование также имело размер выборки только из восьми домашних собак, что может повлиять на результаты, учитывая низкую распространенность Babesia в естественных популяциях домашних собак в Замбии, равную 2.4% [28]. Аналогичная низкая распространенность среди собак Babesia , составляющая 3,8%, была также зарегистрирована в Кабо-Верде [34]. Более широкое исследование с использованием большего количества собак со всей страны было бы более желательным, чтобы всесторонне задокументировать клинико-патологические проявления этого заболевания и определить, существуют ли региональные различия в распространенности Babesia [17], которые могут быть приписаны различиям. в Babesia видов паразитов или распространение переносчиков, как было показано другими исследователями [35].

    Наиболее частыми клиническими проблемами у собак с Babesia в этом исследовании были лихорадка, депрессия, бледность, лимфаденопатия и наличие клещей. В этом исследовании у собак с Babesia инфекциями постоянно наблюдалась лихорадка, при этом у 87,3% была лихорадка, а у 47,4% — лимфаденопатия. У значительной части собак в этом исследовании была лихорадка более 40 ° C, аналогичная температуре 40,4 ° C, описанной Casapulla et al. [36] у собаки, инфицированной B. gibsoni , .В отличие от результатов Adaszek et al. [37], Салем и Фараг [38], Давитков и др. [11], которые обнаружили, что изменение цвета мочи и гемоглобинурия, соответственно, являются важным клиническим открытием, а также единственным необычным случаем, проведенным Demeter et al. [39] с гемоглобинурией, в этом исследовании не было случая гемоглобинурии. Это, однако, может быть связано с тем, что этот клинический признак обычно не наблюдается из-за того, что моча не выводится и не собирается при каждом клиническом обследовании.Кроме того, большинство владельцев могут быть не очень наблюдательными или могут не видеть, как собака выделяет обесцвеченную мочу, и поэтому результаты могут быть занижены. Микроскопическая гемоглобинурия могла также присутствовать в отсутствие явно видимой макроскопической гемоглобинурии.

    Большинство собак были заражены клещами рода Rhipicephalus , и не было статистических различий в зараженности между самцами и самками. Более высокая распространенность рода Rhipicephalus аналогична результатам, полученным Abd Rani et al.[3] в Индии, где также тропический климат, как в Замбии. Несмотря на этот факт, ряд животных представил Babesia без каких-либо эктопаразитов и в анамнезе последовательной борьбы с клещами. Это может быть связано с измененным анамнезом, представленным владельцами из-за возможного чувства вины в сочетании с возможным недавним детискированием до обращения в ветеринарную клинику, когда животные, по-видимому, заболели. Однако аналогичный вывод о том, что примерно только половина животных с диагнозом Babesia заражена клещами, было сообщено Cardoso et al.[40] в Португалии.

    Аналогичным образом, в проспективном исследовании, у ряда животных, у которых клиницисты клинически подозревали бабезиоз, были микроскопические отрицательные результаты на Babesia . Это может быть связано с рядом причин: присущей микроскопии мазка крови низкой чувствительности по сравнению с молекулярно-биологическими тестами, такими как ПЦР; паразитемия также носит временный характер у инфицированных животных, особенно на ранних стадиях инфицирования, и незначительна и не выявляется в хронических случаях [5].Однако, поскольку исследование было разработано для описания клинико-патологических результатов у Babesia -положительных собак, единственным недостатком было уменьшение размера выборки из-за возможных ложноотрицательных результатов, возникающих по вышеупомянутым причинам. Использование ПЦР, вероятно, привело бы к увеличению размера выборки.

    Анемия, ядросодержащие эритроциты и тромбоцитопения были продемонстрированы многочисленными исследователями как последовательные лабораторные данные при бабезиозе собак [37, 38, 41], и это исследование также показало, что анемия характерна для собак с Babesia , но тромбоцитопения наблюдалась только у собак. менее одной пятой собак.

    В целом клинико-патологические данные этого исследования сопоставимы с выводами многих исследователей, таких как Ruiz de Gopegui et al. [13], за исключением гемоглобинурии, которая не наблюдалась в качестве заметного клинического признака в этом исследовании.

    Это исследование, по-видимому, указывает на то, что единичные инфекции, вызванные B. rossi или B. gibsoni , дают более тяжелые гематологические результаты, чем смешанная инфекция. Авторы не могли приписать этому парадоксальному выводу никаких особых причин.Другие исследователи также описали коинфекцию видов Babesia и видов, но также заявляют, что трудно приписать клинические признаки одному конкретному агенту [41]. Подобно Салему и Фарагу [38], в этом исследовании было отловлено больше самцов собак, чем самок. Адашек и др. [17] обнаружили, что кобели более подвержены заражению инфекцией Babesia .

    Различия между собаками местной породы и экзотическими собаками были продемонстрированы там, где экзотические породы были более подвержены [17]. Это исследование, однако, не показало каких-либо различий в клинико-патологических данных между двумя группами.Подобно Adaszek et al. [17], это исследование также показало, что собаки младше одного года были более склонны к заражению Babesia .

    Наше исследование показывает, что большее количество животных имеют коинфекцию как B. gibsoni , так и B. rossi , и лишь некоторые из них имеют единственную инфекцию обоими видами. Это контрастирует с данными о коинфекции B. canis и B. vogeli , сделанными Manzillo et al. [41] в Италии и Kamani et al. [42] с B.canis и B. rossi в Нигерии. Однако доля коинфекций в данном исследовании выше, чем сообщается Adamu et al. в Нигерии [16]. Доля собак с B. gibsoni как единичная инфекция была выше, чем у собак с B. rossi как единичная инфекция. Из-за того, что у большинства животных были коинфекции, было трудно приписать клинические признаки и гематологические аномалии одному виду Babesia [41]. Другие исследователи в Африке [38, 42, 43] и Кабо-Верде [34] не нашли B.gibsoni , а в Южной Африке — только у импортированной собаки [44].

    Бабезиоз можно классифицировать как осложненный и неосложненный, при этом осложненный бабезиоз проявляется как острое серьезное опасное для жизни заболевание [4]. Таким образом, результаты этого исследования демонстрируют, что собачий бабезиоз в Замбии менее вирулентен / остр и, возможно, классифицируется как неосложненный, чем описанный в Южной Африке [14]. Однако рост торговли собаками, происходящими из Южной Африки, увеличивает возможный риск ввоза более вирулентных штаммов Babesia в Замбию, поскольку было показано, что путешествующие собаки вносят патогенов Babesia в Германию [45] и Южную Африку [44]. . B. vogeli , который был зарегистрирован в Южной Африке [44], Египте [38] и Кабо-Верде [13], не зарегистрирован в Замбии. Ограничивающим фактором в этом исследовании был тот факт, что праймеры, использованные в этом исследовании, не были специфичными для B. vogeli . Кроме того, в южноафриканском исследовании [46] не сообщалось о смешанной инфекции между B. rossi и B. vogeli , но наше исследование продемонстрировало высокую долю собак со смешанной инфекцией B. rossi и B.gibsoni .

    Модели употребления наркотиков также демонстрируют изменение тенденций с диминазеном, который использовался в начале десятилетия, и редко использовался, поскольку в большинстве практик исключительно имидокарб дипропионат использовался в качестве предпочтительного противовоспалительного средства. Никакие другие препараты против Babesia , такие как клиндамицин и хинин и атоваквон-азитромицин, о которых сообщалось в литературе [22], не использовались в случаях в исследовании.

    В заключение, это исследование выделяет виды собак Babesia , присутствующие в Замбии, а также клинико-патологические данные о собачьих бабезиозах.Он также подчеркивает различия между проявлениями болезни бабезиоза собак в Замбии и других странах субрегиона.

    Конфликт интересов

    Авторы этого документа заявляют, что ни один из них не имеет каких-либо финансовых или личных отношений с отдельными лицами или организациями, которые могли бы неприемлемо повлиять на содержание этого документа.

    Выражение признательности

    Авторы выражают признательность следующим лицам: г-ну М. Масуку, сотрудникам ветеринарной клиники Showgrounds, ветеринарной клиники Vet-Serve и ветеринарных клиник Университета Замбии, Dr.Дж. Чиджиква за сбор и обработку образцов, а также госпожу П. Банда-Чишимба за ввод данных.

    Обновление

    : COVID-19 в обзоре животных, часть 1: кошки

    Еще в октябре / ноябре 2020 года я написал серию сообщений о том, что мы знаем о SARS-CoV-2 и различных видах животных. Это динамическое поле, так что пора обновить их. Мы начнем с самого начала с одного из наиболее восприимчивых домашних животных: кошек. Многие исследования SARS-CoV-2 у кошек за последний год в значительной степени подтвердили наши первоначальные наблюдения и помогли уточнить то, что мы знаем.

    Восприимчивы ли кошки к вирусу SARS-CoV-2?

    Да, кошки явно восприимчивы. Здесь никаких изменений. Мы знаем, что какое-то время это подтверждали новые исследования. Подробнее об этом ниже.

    Как часто кошки заражаются?

    Сейчас много статей о SARS-CoV-2 у кошек. Некоторые очень хороши. Некоторые из них представляют собой интересные, но малоэффективные отчеты об отдельных случаях, а некоторые представляют собой поспешные исследования («Я хочу быть первым, а не лучшим»), в которых используются небольшие размеры выборки, нечеткие группы населения или выбор интересных результатов из того, что должно было быть более полным. , большие исследования.

    В целом очевидно, что передача от человека кошке распространена в домохозяйствах, где люди заражены COVID-19. В небольшом количестве исследований изучалась активная инфекция с использованием ПЦР-тестирования +/- изоляция вируса, что сложно осуществить с точки зрения логистики. Выявить инфицированных людей, организовать обследование их домашних животных и (как правило) пойти в дом для этого — это большая работа. Исследование, проведенное в Техасе (Hamers et al. 2021), выявило вирус у 3/17 (18%) кошек в инфицированных семьях. Результаты нашего канадского исследования (которые были представлены, но еще не опубликованы) были довольно схожими.

    Тестирование на наличие вирусов рассказывает нам только часть истории из-за трудностей с отбором образцов зараженных кошек достаточно быстро, чтобы поймать их во время кратковременного периода активного выделения. Мы предполагаем, что часто пропускаем инфекции, потому что слишком поздно попадаем в дом, чтобы взять образец. Вот почему все больше исследований основано на поиске антител в крови домашних кошек как индикатора перенесенной инфекции. Это менее однозначно, чем обнаружение вируса, поскольку эффективность тестов на антитела может быть разной, но с хорошими тестами это действительно может помочь нам понять ситуацию.

    Когда мы смотрим на антитела к SARS-CoV-2 у кошек в инфицированных семьях, очевидная частота инфицирования возрастает. В исследовании, проведенном в Техасе, сообщалось, что серологическая распространенность (процент кошек с антителами) составляет 44% (7/16), а серологическая распространенность по нашим предварительным данным из Канады была даже выше — 67%. Другие исследования дали разные результаты (например, исследование, проведенное в Перу, показало, что среди кошек из инфицированных домохозяйств распространенность серотипа составляет 17-30%, в зависимости от того, как интерпретировалось тестирование), но главный вывод заключается в том, что от человека к кошке передача SARS-CoV-2 довольно распространена.

    Существует также много исследований, в которых изучались антитела против SARS-CoV-2 в общей популяции кошек, обычно без какой-либо информации о том, контактировали ли кошки с инфицированным человеком. Эти исследования довольно легко провести (например, путем тестирования остатков крови из образцов, собранных для других целей, или сбора удобных образцов от кошек, представленных в ветеринарные клиники или приюты), но их ценность варьируется. Обычно в этих исследованиях сообщается о низкой распространенности серотипа среди кошек.В одном исследовании сообщалось о распространенности, близкой к 10%, но чаще встречается <2% (например, Dileepan 2021, Klaus 2021, Smith 2021, Stranieri 2021, Udom 2021, van der Leij 2021). Положительными могут быть кошки, у которых действительно были инфицированные владельцы, но информация не была известна и не была собрана, или ложные положительные результаты из-за несовершенного теста. В нашем исследовании наблюдения за кошками из приютов или клиник по стерилизации / стерилизации мы обнаружили, что история кошек часто очень ограничена (например, кошки, недавно приобретенные у Киджи), поэтому мы не можем использовать историю, чтобы поместить результаты в контекст.

    Между возникновением болезни и публикацией отчетов всегда есть задержка, поэтому можно ожидать, что уровень инфицирования кошек со временем будет увеличиваться по мере продолжения пандемии среди людей и увеличения числа зараженных кошек.

    Факторы риска заражения кошек еще не были тщательно изучены, часто из-за довольно небольшого размера исследований. Бразильское исследование показало, что кошки, которые спали в постели, имели более высокий риск серопозитивности (Calvet 2021), что мы также обнаружили в нашем канадском исследовании.Это не слишком удивительно, поскольку вещи, которые увеличивают тесный контакт (прямое или совместное воздушное пространство), предположительно, увеличивают риск передачи от человека к кошке.

    Болеют ли кошки SARS-CoV-2?

    Могут, но чаще всего этого не делают. Экспериментально клинические признаки у кошек ничем не примечательны. Сообщается, что большинство инфицированных кошек здоровы, но это не всегда так. Есть сообщения о больных кошках, в том числе статья, описывающая смертельную инфекцию кошки в Великобритании.

    По данным нашего наблюдения, кошки, у которых были антитела против вируса, чаще регистрировались как заболевшие в то же время, что и владелец, инфицированный COVID-19, но в большинстве случаев любое заболевание у кошек было легким (например, кашель). , чихание, тише обычного). Я получаю множество анекдотических сообщений о больных кошках, которые подверглись воздействию вируса, и подозреваю, что многие из них действительно связаны с SARS-CoV-2. Когда у здоровой взрослой домашней кошки, не контактирующей с другими кошками, появляются признаки инфекции верхних дыхательных путей примерно в то время, когда ее владелец болел COVID-19, других возможных причин болезни кошки не так много.Однако, в то же время, поскольку заражение кошек кажется довольно распространенным явлением, мы ожидаем обнаружить случайное заражение кошек, которые заболевают или умирают от различных других не связанных между собой вещей. Небольшое исследование, проведенное Центром контроля заболеваний США (еще не опубликованное), изучило это, и вывод заключался в том, что некоторые случаи тяжелых заболеваний, казалось, имели место, но в большинстве случаев кошки, которые умерли во время заражения, не умирали от последствий. SARS-CoV-2.

    Как и люди, кошки, подвергшиеся наибольшему воздействию, вероятно, не болеют или не болеют в легкой форме.Некоторые из них заболевают более серьезным заболеванием, а меньшее количество может даже умереть от инфекции. Относительный размер этих различных групп полностью неизвестен.

    Могут ли кошки заражать других животных SARS-CoV-2?

    Да. Экспериментально было показано, что кошки заражают других кошек. Это также было замечено за пределами лаборатории, например, громкая вспышка среди львов и тигров в зоопарке Бронкса, где передача вируса от кошки к кошке была более вероятной, чем заражение всех больших кошек людьми индивидуально.Мы также исследовали одну большую группу зараженных кошек, и, скорее всего, там тоже было распространение от кошки к кошке, а не все инфекции от человека к кошке.

    Могут ли кошки заражать людей SARS-CoV-2?

    Мы до сих пор не знаем наверняка, происходит ли заражение от кошки к человеку. Поскольку кошки могут заразить других кошек, мы должны предположить, что существует некоторый риск заражения ими людей, но определить, насколько этот риск существует, непросто. Если кто-то заразился кошкой, было бы очень сложно определить, заразился ли он от кошки, а не от контакта с человеком, потому что вирус все еще широко циркулирует среди людей, и контакт с зараженной кошкой, вероятно, совпадет с контактом с этим. зараженный хозяин кошки (вероятно, зараженный).

    Я думаю, мы должны предположить, что передача вируса от кошки человеку биологически возможна и, вероятно, имела место. Однако в реальном мире это, вероятно, очень редко, учитывая динамику общения кошки с человеком. Если мой кот заразится, он заразится вирусом от меня, моей жены или моих детей. В этом случае передача от кошки другим людям в доме возможна, но передача от человека к человеку гораздо более вероятна. Большинство кошек редко встречаются с разными людьми, особенно когда их хозяева больны.Самый большой риск вероятен, когда кошка покидает дом, например, в ветеринарную клинику, или ее сдают в приют. Мы обнаружили зараженных кошек в приютах, так что это вполне вероятный сценарий, и поэтому мы рекомендуем узнать о статусе инфицирования владельца, прежде чем приносить животных в клиники, приюты или другие места за пределами дома.

    Есть ли у нас вакцина против SARS-CoV-2 для кошек и стоит ли вакцинировать кошек?

    Мои текущие ответы — «отчасти» и «нет».«Существует вакцина против SARS-CoV-2 (безопасность и эффективность неизвестной), лицензированная для использования у кошек в России. В Северной Америке есть экспериментальная вакцина, которую использовали для норок и некоторых животных в зоопарках, и это был бы лучший вариант, если бы нам понадобилась вакцина. Однако я не вижу в этом необходимости, учитывая очевидную редкость тяжелого заболевания. Более подробная информация о возможной полезности (или нет) вакцин против SARS-CoV-2 для домашних животных содержится в предыдущем посте.

    Могут ли кошки быть важным резервуаром SARS-CoV-2, если им управлять у людей?

    Наверное, нет.Кошки довольно восприимчивы к вирусу, но не распространяют его надолго. Для поддержания циркуляции вируса в популяции кошек инфицированная кошка должна будет взаимодействовать с другой восприимчивой кошкой в ​​течение нескольких дней (и так далее…). Большинство кошек этого не делают. В общинных кошачьих колониях я видел, как он распространяется по группе, но он, скорее всего, быстро сгорит, поскольку большинство кошек заразятся и выздоровеют, если предположить, что есть некоторая степень иммунитета к повторному заражению (что, похоже, так).Чтобы поддерживать вирус в популяции, когда он переносится только в течение короткого периода времени, вам нужно много животных и много контактов между животными. Это больше беспокоит некоторые виды диких животных (но это отдельная история).

    Могут ли кошки быть источником новых вариантов SARS-CoV-2?

    Наверное, нет. Варианты возникают из-за случайных мутаций. Это происходит при репликации вируса. Таким образом, риск появления варианта прямо пропорционален продолжительности передачи (и, следовательно, репликации вируса).Поскольку мы не ожидаем устойчивой передачи в популяции кошек, существует ограниченный риск появления там разновидностей.

    Итак, стоит ли беспокоиться о SARS-CoV-2 у кошек?

    Беспокойство, нет, но мы должны обратить на это внимание. Существует риск для здоровья кошек, и мы хотим избежать этого, сократив контакт инфицированных людей с кошками. Это, вероятно, наиболее важно для пожилых кошек и кошек с заболеваниями, которые могут сделать их более восприимчивыми к тяжелым заболеваниям.

    Риск распространения вируса в доме кошками ограничен, но его нельзя игнорировать.Когда кто-то изолирован от остальной части семьи (например, живет в подвале), мы хотим убедиться, что домашние животные, такие как кошки, учитываются, чтобы они не отслеживали вирус от инфицированного человека до остальной семьи. Легко увидеть, как кто-то может отлично справиться с тем, чтобы держаться подальше от других людей, но не думать о кошке, которая бегает туда-сюда между ними и остальной семьей.

    Мы также не хотим, чтобы кошки отслеживали вирус вне дома и выставляли напоказ других кошек или диких животных.Вероятность того, что это вызовет большую проблему или создаст резервуар для диких животных, очень мала, но не равна нулю. Немного осмотрительности имеет смысл. Держите кошек в помещении, если они контактируют с инфицированными людьми.

    Что делать с кошками?

    Это не изменилось с первого поста….

    • Кошки тоже люди, если говорить о SARS-CoV-2.
    • Если вы инфицированы, постарайтесь держаться подальше от животных — всех животных, людей и других.
    • Если ваша кошка подверглась воздействию SARS-CoV-2, держите ее внутри и подальше от других.

    Микроорганизмов | Бесплатный полнотекстовый | Babesia pisicii n. sp. и Babesia canis заражают европейских диких кошек, Felis silvestris, в Румынии

    1. Введение

    Род Babesia состоит из гемопаразитов, передаваемых апикомплексными клещами, которые оказывают заметное экономическое, медицинское и ветеринарное воздействие на домашних и диких животных [1,2, 3]. Более того, виды Babesia приобретают все больший интерес как потенциальные этиологические агенты зоонозных заболеваний [4,5]. С момента первого описания микроорганизма в эритроцитах румынского крупного рогатого скота Виктором Бабешем в конце 19 века было описано более 100 новых видов [6,7].Растущее число доступных митохондриальных последовательностей свидетельствует о том, что видовое разнообразие пироплазмид в дикой природе Европы сильно недооценивается [8,9]. Четкая дифференциация видов и понимание спектра их хозяев необходимы для идентификации паразита в исчезающих диких видах и для правильной диагностики клинических случаев у домашних животных. Бабезиоз кошек считается эндемическим заболеванием в Южной Африке, хотя Babesia spp. спорадически регистрируются из разных стран Европы, Азии или Америки [10].В прошлом веке несколько видов Babesia spp. были описаны только на основании морфологических характеристик или специфичности хозяина, включая B. felis, B. cati, B. herpailuri и B. pantherae [11,12,13,14]. Однако после этого молекулярно охарактеризовали только B. felis [15]. На основании молекулярных данных, виды B. leo, B. lengau и Babesia Western Cape также были зарегистрированы в Южной Африке [15,16,17]. В Азии B. canis presentii и B. hongkongensis были зарегистрированы и молекулярно охарактеризованы у домашних кошек [18,19].Кроме того, B. microti, а также связанные с собаками виды, такие как B. canis, B. gibsoni и B. vogeli, были идентифицированы у кошачьих на основе молекулярных данных [20,21,22,23]. Подавляющее большинство депонированных последовательностей представлено последовательностями гена субъединицы малой рибосомной РНК (18S рДНК), в то время как доступно небольшое количество внутренних транскрибируемых спейсеров, 5S рРНК, 28S рРНК или последовательностей бета-тубулиноподобных генов. Однако для сравнения доступна только одна митохондриальная последовательность (цитохром b (Cytb) B. hongkongensis, инвентарный номер JQ867357), что может ограничивать филогенетический анализ специфичных для кошек видов Babesia spp.В Европе данные по Babesia spp. инфекции у кошачьих носят спорадический и непостоянный характер. У европейских диких кошачьих Babesia была обнаружена у одной особи из Боснии и Герцеговины, и на молекулярном уровне она была охарактеризована как идентичная Babesia sp. ранее обнаружен у барсуков [24]. Наличие внутриэритроцитарных мерозоитов, совместимых с малыми Babesia / Cytauxzoon spp. был зарегистрирован у дикой кошки в северной Греции; однако результаты не подтверждаются молекулярными данными [25]. У домашних кошек молекулярные находки B.canis, B. vogeli или B. microti были зарегистрированы в Испании, Португалии, Польше и Италии [20,22,26,27]. Это резко контрастирует с многочисленными сообщениями о заражении бабезией домашних собак в Европе в течение последних десятилетий с уровнем распространенности от 0,1 до 88,0% [28]. Настоящее исследование было вызвано отсутствием соответствующих данных о бабезии в европейской дикой природе felids и по нашим данным о B. canis у кошачьих в ходе других исследований пироплазмы кошек [9]. Поэтому мы стремились понять разнообразие кошачьей бабезии у диких кошачьих в Румынии с использованием рДНК 18S и последующей молекулярной характеристикой путем анализа двух митохондриальных маркеров, генов Cytb и гена субъединицы I цитохром с оксидазы (COI).

    3. Результаты

    3.1. Анализ последовательности 18S рДНК
    Babesia spp. инфекция была обнаружена путем амплификации и секвенирования фрагмента 376 п.н. рДНК 18S у 20 диких кошачьих (39,2%; 95% ДИ: 27,0–52,9). Все полученные последовательности были идентичны друг другу, и анализ BLAST показал 100% сходство с B. canis, выделенным от собак из Литвы, Ирана, Боснии и Герцеговины, лисиц из Польши и т. Д. (Инвентарные номера GenBank: MN078319-MN078323). , MN173223, MN134074, MK107806).Все положительные образцы получены от европейских диких кошек, в то время как ни одна из семи евразийских рысей не оказалась положительной. Географическое происхождение образцов, включенных в исследование, и их положительность показаны на Рисунке 1.

    Из 20 положительных образцов F. silvestris 14 (27,5%; 95% ДИ: 17,1–41,0) дали ампликон в анализе, нацеленном на Фрагмент гена 18S рДНК размером 1670 п.н. Однако присутствие B. canis было подтверждено только в двух образцах прямым секвенированием (100% идентичность с B. canis из Румынии и Эстонии; инвентарные номера GenBank: KX712122, HQ662634, KT008057).Другие ампликоны представляют собой представителей рода Cytauxzoon и Hepatozoon, коамплифицированных с помощью анализа.

    3.2. Оценка чувствительности анализа, нацеленного на фрагмент 376 п.н. рДНК 18S
    Чувствительность вложенного ПЦР-анализа, нацеленного на фрагмент 376 п.н. рДНК 18S, была установлена ​​к отдельной молекуле в реакции после второго раунда ПЦР. В первом раунде ПЦР предел обнаружения составил 10 2 копий ДНК-матрицы (дополнительный файл: рисунок S1). Прямое секвенирование подтвердило присутствие B.canis 18S рДНК во всех продуктах ПЦР, которые давали видимые полосы в обоих раундах ПЦР.
    3.3. Анализ митохондриальных генов
    Для оценки генетической изменчивости Babesia spp. присутствуют у диких кошачьих, был проведен анализ последовательности двух митохондриальных генов (Cytb и COI). Амплификация фрагмента гена Cytb была успешной в четырех из 20 положительных образцов 18S рДНК (7,8%; CI: 3,1–18,5). Прямое секвенирование дало высококачественные Babesia spp. консенсусные последовательности 556–582 нуклеотидов для всех этих четырех образцов.Последовательность из образца 3569 показала 99,8% идентичности с B. canis из США (инвентарный номер KC207822) по данным анализа BLAST. Ближайшим родственником из оставшихся трех последовательностей (идентичных друг другу на 100%) был B. rossi с идентичностью 87,2–89,7% (инвентарный номер KC207823). Все эти три последовательности произошли от диких кошек из степного экорегиона (рис. 1).

    Митохондриальный маркер COI был амплифицирован из тех же четырех образцов. Последовательность из образца 3569 показала 99,7% идентичности с вышеупомянутым B.canis из США (инвентарный номер KC207822). Остальные три последовательности (идентичные друг другу на 99,9–100%) также показали идентичность на 84,3–89,7% с тем же B. rossi (инвентарный номер KC207823).

    Попарное сравнение митохондриальных генов этого нового генотипа бабезии показало генетическое расстояние не менее 10,3% как в генах Cytb, так и в генах COI от наиболее близкородственных видов, B. rossi. Еще более высокие расстояния нуклеотидных последовательностей были получены между новым генотипом и B. canis или B.vogeli (Таблица 2, расстояния между последовательностями на уровне аминокислот доступны в дополнительном файле: Таблица S1). Филогенетический анализ обоих митохондриальных генов был основан на доступных в GenBank последовательностях видов Babesia sensu stricto (clade X sensu Jalovecká et al. [35] ) и последовательности, полученные в ходе текущего исследования. Все новые последовательности генотипа Babesia сформировали отдельный и хорошо поддерживаемый субклад как в филогении Cytb, так и в COI, в сестринском положении по отношению к B. rossi (рисунок 2 и рисунок 3). Кроме того, этот субклад расположен дальше от последовательностей, представляющих B.vogeli и B. canis clade. Последовательности B. canis из этого исследования сгруппированы вместе с другими опубликованными последовательностями Cytb и COI B. canis.

    Все уникальные последовательности, полученные в этом исследовании, депонированы в базе данных GenBank под номерами доступа MW939359 (18S рДНК), MW938761 (ген Cytb), MW938763 (ген COI) для B. canis и MW939360 (18S рДНК), MW938762 (ген Cytb). ), MW938764-MW938765 (ген COI) для нового генотипа бабезии.

    На основании этих данных мы описываем этот генотип как новый вид Babesia.

    3.4. Таксономическая сводка и описание видов

    Отряд Piroplasmida Poche, 1913.

    Семейство Babesiidae du Toit, 1918.

    Род Babesia Starcovici, 1893.

    Babesia pisicii n. sp. Панаит, Раздилова и Михалка.

    Диагноз: Организм представляет собой вид простейших пироплазмид из рода Babesia, отличающийся от сородичей других плотоядных животных по последовательностям ДНК и образующий отдельную кладовую сестру B. rossi.

    Тип-хозяин: Felis silvestris Schreber, 1777 (Carnivora: Felidae).

    Типовой населенный пункт: Мила 23, Тулча (45,22 ° N, 29,24 ° E).

    Типовой материал: Экстракт ткани и выделенная общая ДНК депонированы в Музее естественной истории «Григоре Антипа», Бухарест, Румыния, под номерами коллекции BAB 001 (ткань) и BAB 002 (ДНК). В соответствии с кодом ICZN (статьи 72.5.4, 73.3) [40], депонированный материал считается гапантотипом по своему характеру.

    последовательностей ДНК: последовательностей ДНК, амплифицированных из типового материала, депонированы в GenBank под номерами доступа: MW939360 (18S рДНК), MW938762 (ген Cytb), MW938764 (ген COI).

    Другие населенные пункты: Румыния : Каталой, Тулча (45,10 ° N, 28,72 ° E), Сомова, Тулча (45,19 ° N, 28,67 ° E).

    Распространенность: 3/51 (5,9%)

    Этимология: специфический эпитет pisicii происходит от румынского термина, используемого для обозначения кошек. Имя дается в виде существительного в родительном падеже, в соответствии с правилами и рекомендациями ICZN.

    4. Обсуждение

    Исторически Babesia spp. дифференциация была основана на предполагаемой специфичности хозяина и фенотипических характеристиках, таких как размер интраэритроцитарных стадий и количество мерозоитов, наблюдаемых при микроскопической визуализации мазков крови [2].В настоящее время развитие молекулярных методов и доступность обширных молекулярных данных поставили под сомнение специфичность хозяина и позволили идентифицировать виды [34,41,42]. В Европе внутриэритроцитарные паразиты рода Babesia были молекулярно идентифицированы у широкого круга млекопитающих-хозяев, в том числе крупный рогатый скот [43,44], мелкие жвачные животные [45,46], различные виды оленей [8], лошади [47], свиньи [48], лабораторные грызуны [49], зайцы [50], кроты [51], летучие мыши) [52], а также различные хищники, такие как собаки [34,53], волки [54], шакалы [55], лисы [56], кошки [26,27] и куньи [57].Частое использование универсальных праймеров, выявляющих рДНК 18S широкого спектра апикомлексных паразитов (Babesia – Theileria – Hepatozoon – Cytauxzoon) [24,58,59,60], часто может приводить к амплификации других паразитов, кроме Babesia spp. в образцах, коинфицированных другими apicomplexans крови, такими как Cytauxzoon spp. [9,61] и Hepatozoon spp. [24,62]. Как следствие, имеется единственное сообщение о Babesia sp. у дикой кошки [24] в Европе. Хотя B. canis обычно считается видом, связанным с псовыми, в течение последних десятилетий сообщалось также о его присутствии у других хозяев, таких как летучие мыши [63], лошади [64], и домашние кошки [20,26].Однако все эти отчеты основаны на обнаружении 18S рДНК, которое имеет ограничения в различении очень близкородственных видов Babesia из-за недостаточной вариабельности последовательностей [2,34,65]. Более того, недавно было продемонстрировано, что ДНК B. canis может быть обнаружена у мышей, экспериментально вскармливаемых естественно инфицированными клещами Dermacentor reticulatus [66]. Таким образом, обнаружение B. canis с использованием тестов 18S рДНК у кошачьих может быть связано с неспецифическим обнаружением близкородственных видов или с возможным приемом B.canis sensu stricto от молок или их клещей. Разграничение видов пироплазмид на основе митохондриальных последовательностей было недавно продемонстрировано и применено для описания близкородственных видов [9]. Даже если последовательности из 39,2% протестированных образцов показали 100% сходство с B. canis после анализа короткого фрагмента 18S рДНК, результаты, полученные в анализах митохондриальных маркеров, подтвердили присутствие B. canis только в одном образце, в то время как B. pisicii n. sp. был идентифицирован у трех человек.Следовательно, после точной специфической идентификации пироплазм необходимо подтвердить вид с помощью митохондриальных маркеров. Однако протоколы, используемые для амплификации митохондриальных генов, имеют в 100-1000 раз более низкую чувствительность, чем специфический анализ, нацеленный на фрагмент 376 п.н. рДНК 18S B. canis, как было продемонстрировано Hrazdilová et al. [34]. В этом исследовании свежая кровь не была доступна для исследования внутриэритроцитарных стадий. Однако, как было показано ранее [67], описание новых видов без морфологической идентификации становится все более распространенной практикой и применяется также для других пироплазм [9,68], поскольку морфологические различия между внутриэритроцитарными стадиями пироплазм в основном незначительны. .Более того, низкая паразитемия у естественно инфицированных диких хозяев вряд ли даст в будущем микроскопически положительные мазки крови. Филогенетический анализ митохондриальных генов показал, что B. pisicii n. sp. относится к так называемой «большой» бабезии собак, образуя отдельный субклад в сестринской позиции по отношению к B. rossi. Филогения, основанная на последовательностях 18S рДНК [42], показала, что большинство ассоциированных с кошачьих бабезий группируются в отдельные клады от B. canis, за исключением B. canis presentii, B.hongkongensis и Babesia sp. Западный Кейп. Однако анализ последовательности 18S рДНК позволяет отличить эти три изолята Babesia от B. canis, чего нельзя сказать о B. pisicii n. sp. необходимы дальнейшие исследования для уточнения спектра хозяев B. pisicii n. sp., главным образом его наличие и клиническое значение для домашних кошек. Кроме того, выяснение его жизненного цикла и вектора клещей требует внимания в будущем. Ixodes ricinus и I. hexagonus были единственными видами, обнаруженными на диких кошачьих в Румынии [69], и оба вида обитают в районе, где B.pisicii n. sp. был найден. Следовательно, векторная способность клещей переносить эту новую Babesia sp. Остается исследовать.

    Бабезиоз: Кошки | Симпозиумы Visa Vis

    Быстрые ссылки

    Бабезиоз у собак

    Бабезиоз у лошадей

    Бабезиоз

    Клинические признаки и симптомы:

    Бабезиоз кошек обычно протекает как хроническое заболевание низкой степени тяжести.

    • Летаргия (слабость / потеря энергии)
    • Шерсть грубая
    • Пирексия — редко (лихорадка)
    • Гемолитическая анемия (анемии, вызванные разрушением эритроцитов)
    • Бледность слизистых оболочек
    • Гемоглобинурия (темно-красная, гемоглобинсодержащая моча)
    • Иктеричность — нечасто (Желтуха — пожелтение кожи и глаз, вызванное слишком большим количеством билирубина в крови)
    • Депрессия
    • Анорексия (потеря аппетита, ведущая к потере веса)
    • Тахикардия (учащенное сердцебиение)
    • Тахипноэ (учащенное дыхание)
    • В тяжелых случаях: отек легких, гепатопатия (заболевание печени) и дисфункция центральной нервной системы

    Бледность слизистых оболочек вследствие анемии

    Многие клинические признаки являются вторичными по отношению к гемолитической анемии, которая возникает в результате интраэритроцитарной инфекции, вызванной пироплазмами.Кошки обычно приспосабливаются к анемии и могут иметь лишь легкие клинические признаки до тех пор, пока не окажутся в состоянии стресса. Сопутствующее инфицирование Mycoplasma haemofelis , вирусом лейкемии кошек (FeLV) или вирусом иммунодефицита кошек (FIV) может способствовать клинической картине и тяжести заболевания.

    К началу


    Серологический анализ не может быть надежно использован у домашних кошек, поскольку референтные интервалы для серологических титров, связанных с бабезиозом, не установлены.

    Выявление внутриклеточных пироплазм в эритроцитах в мазке периферической крови, окрашенном по Романовскому или Гимзе, может быть затруднено, поскольку маленькие пироплазмы могут быть морфологически неразличимы, а уровень паразитемии может быть низким. Следовательно, лучшая стратегия для окончательной диагностики интраэритроцитарной пироплазмы — это молекулярные методы.

    Определение Babesia spp. Методом полимеразной цепной реакции (ПЦР). ДНК — полезный метод документирования инфекции в образце крови.

    К началу


    Для лечения экспериментальных инфекций B.felis у домашних кошек. Испытания дали неоднозначные и сомнительные результаты. Исследования также показали, что для эффективного лечения бабезиоза кошек может потребоваться повторная или хроническая противопротозойная терапия.
    В тяжелых случаях анемии может потребоваться переливание крови.

    Примечание для ветеринаров: для получения более полного списка потенциальных противопаразитарных препаратов обратитесь к таблице 77-3 в книге Грина «Инфекционные болезни собак и кошек».

    К началу


    В настоящее время коммерчески недоступна эффективная вакцина для защиты кошек от бабезиоза.

    К началу


    Бабезиоз у собак

    Бабезиоз у лошадей

    Вернуться к: Бабезиоз

    Nexus Academic Publishers (NAP)

    Оптимизация полимеразной цепной реакции для молекулярного обнаружения Babesia Felis у домашних кошек

    Мухаммад Юнус Хан1, Харун Акбар1, Рахила Ахтар2 *, Васим Шехзад3, Сахер Ислам3, Бениш Захид4

    1 Кафедра паразитологии, Университет ветеринарии и зоотехники, Лахор, Пакистан.54000; 2 Кафедра патологии Университета ветеринарии и зоотехники, Лахор, Пакистан 54000; 3Институт биохимии и биотехнологии (IBBt), Университет ветеринарии и зоотехники, Лахор, Пакистан 54000; 4 Кафедра зоологии Пенджабского университета, Пакистан.

    Редактор | Мухаммад Имран Рашид, Департамент паразитологии, Университет ветеринарии и зоотехники, Лахор, Пакистан.

    Поступило | 13 апреля 2018 г .; Принято | 06 мая 2018 г .; Опубликовано | 25 июня 2018 г.

    * Переписка | Рахила Ахтар, отделение патологии, Университет ветеринарии и зоотехники, Лахор, Пакистан.54000; Эл. Почта: [email protected]

    Цитирование | Хан М.Ю., Акбар Х., Ахтар Р., Шехзад В., Ислам С., Захид Б. (2018). Оптимизация полимеразной цепной реакции для молекулярного обнаружения бабезии фелис ​​у домашних кошек. J. Adv. Паразитол. 5 (2): 22-24.

    DOI | http://dx.doi.org/10.17582/journal.jap/2018/5.2.22.24

    Авторские права © 2018 Khan et al. Это статья в открытом доступе, распространяемая по лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

    ВВЕДЕНИЕ

    Бабезиоз вызывается внутриэритроцитарным гемопротозойным, называемым бабезией, у млекопитающих, птиц и рептилий. Нельзя игнорировать экономическое значение этого заболевания из-за гемолитической анемии, за которой следует повышенная летальность (Laha et al., 2015). Бабезиоз обычно диагностируется с помощью световой микроскопии, когда в тонких мазках крови, окрашенных по Гимзе, наблюдаются пироплазмы. Однако обнаружить бабезию с помощью световой микроскопии может быть сложно, особенно при хронической инфекции и низкой паразитемии.Полиморфизм паразита, связанный с лекарственной устойчивостью, может быть причиной ложных результатов, если микроскопическая оценка не проводится опытным персоналом (Jiang et al., 2015). Кроме того, обнаружение антител с помощью иммуноферментного анализа (ELISA) и иммунофлуоресцентного теста на антитела не дает прямой информации об активной инфекции Babesia (Maharana et al., 2016). Чтобы назначить точное и подходящее лечение бабезиоза, необходимо идентифицировать как виды, так и генотипы, поскольку разные виды-инфекторы приводят к разной степени тяжести заболевания и реакции на лечение (Brikenheuer et al., 2003). Это подчеркивает необходимость молекулярной диагностики видов бабезий. Поскольку по обнаружению Babesia felis на основе полимеразной цепной реакции (ПЦР) не было много работ, особенно в Пакистане, где не проводилось ни одного исследования для молекулярного обнаружения B. felis, настоящее исследование было разработано для оптимизации ПЦР для подтверждающей диагностики B. felis у домашних кошек Лахора, Пакистан.

    МАТЕРИАЛЫ И МЕТОДЫ

    Сто (n = 100) образцов крови были собраны в Центре домашних животных Университета ветеринарии и зоотехники, Лахор, Пакистан, у домашних кошек с подозрением на бабезиоз.Основными критериями подозрения на бабезиоз были бледность слизистой оболочки, гемолитическая анемия, грубая шерсть и гемоглобинурия. Тонкие мазки крови, окрашенные Гимза, исследовали под микроскопом на предмет обнаружения внутриэритроцитарных телец. Размер внутриэритроцитарных телец также определяли с помощью микрометра. Микроскопически положительные образцы использовали для оптимизации ПЦР. ДНК выделяли с использованием набора для ДНК TIANamp Blood (Cat # DP318, Tiangen, China).

    Дизайн грунтовки

    Оптимизация градиентной полимеразной цепной реакции (ПЦР): образцы крови также использовали для обнаружения Babesia с помощью ПЦР со специально разработанными праймерами Babesia против гена 18S рРНК с использованием следующего набора праймеров:

    Нападающий Реверс
    B-felis-PB-F 5’TTATTCGGACTGAGAAACTTAGAT3 ’

    5’AGGTTCACAAAACTTCCCAA3 ’

    Два (2) мкл каждого препарата ДНК добавляли к 48 мкл реакционной смеси, состоящей из 1.5 ед. ДНК-полимеразы Taq (Promega, Мэдисон, Висконсин, США), 200 мМ каждого dNTP, 25 пмоль каждого праймера, 5 мкл 10X буфера для ПЦР, 1,5 мМ MgCl2 (Promega, Мэдисон, Висконсин, США) и оставшаяся вода. Цикл реакции ПЦР состоял из начальной денатурации при 94ºC в течение 10 минут, затем 40 циклов денатурации при 94ºC в течение 30 секунд, температуры отжига в градиентной ПЦР 55-65ºC. Окончательное удлинение было выполнено при 72ºC в течение пяти минут с последующим этапом выдержки при 4ºC. Используя вышеупомянутые праймеры, пара Babesia felis была амплифицирована при температуре плавления 58ºC размером 102 п.н.

    Секвенирование продуктов ПЦР и филогенетический анализ: продукты ПЦР секвенировали с использованием прямого праймера и выравнивали с помощью биоинформатического инструмента (BLAST), а филогенетические анализы выполняли в программе Mega Align гена DNASTAR Laser. Данные были проанализированы с использованием критерия хи-квадрат (χ2).

    РЕЗУЛЬТАТЫ

    Результаты настоящего исследования показали шесть положительных образцов Babesia felis с помощью микроскопии и 14 образцов с помощью ПЦР с размером ампликона 102 п.н. (Рисунок 1).Кроме того, наблюдался повышенный процент ПЦР Babesia felis у местных пород (16,6%) по сравнению с персидскими (13,33%) и сиамскими (11,11%). Настоящее исследование также определило возрастную распространенность бабезиоза. Кошки были разделены на три возрастные группы; младше 1 года, 1-3 года и 4-6 лет. Результаты ПЦР показали, что самый высокий процент был обнаружен у молодых кошек в возрасте до 1 года (15,38%), за которыми следуют 4-6 лет (14,28%) и 1-3 года (12,5%). Подобным образом повышенный процент Babesia felis наблюдался у кошек (15%) по сравнению с самцами (12.5%).

    Наши результаты показали некоторые новые открытия во время филогенетического анализа, когда одна последовательность кластеризовалась с другими последовательностями Babesia felis из банка генов (рис. 2), в то время как были обнаружены две совершенно новые последовательности. Одна из этих последовательностей примерно на 48% похожа на Plasmodium yoelii, вид, обнаруженный у мышей. Третья последовательность имела 69% сходство с Parascaris equorum. Причины этого могут быть в загрязнении или еще предстоит изучить.

    ОБСУЖДЕНИЕ

    Дифференциальное количество положительных образцов при микроскопии и ПЦР указывает на различные уровни обнаружения обоих методов.В микроскопии простейшие из-за их небольшого размера могут быть легко пропущены. Это требует технических навыков микроскопии или какой-либо альтернативной техники с большей способностью к обнаружению.

    В настоящем исследовании частота положительных образцов Babesia felis при микроскопии была почти вдвое выше, чем в предыдущих исследованиях (Ahmad et al., 2011), проведенных в том же исследовательском центре с использованием микроскопии. Это можно объяснить растущей распространенностью бабезиоза. Хотя ПЦР дала в четыре раза больше положительных образцов, чем сообщалось ранее (Ahmad et al.2011).

    Увеличение заболеваемости среди местных пород кошек по сравнению с предыдущими исследованиями Ahmad et al. (2011), которые обнаружили наибольшую распространенность на сиамском языке и наименьшую — на персидском. Это также может быть связано с разной чувствительностью применяемых методов (микроскопия или ПЦР). Повышенная распространенность Babesia felis у кошек более молодого и старшего возраста может быть связана со снижением иммунитета в этих возрастных группах.

    Присутствие Plasmodium yoelii у кошек, инфицированных Babesia, может быть важным открытием, поскольку оно может быть результатом прыжка с одного хозяина на другой (от мыши к кошке).Остальные возможные варианты — это комары, которые уже являются хорошо известными промежуточными хозяевами плазмодия. Это также может вновь подтвердить гипотезу о том, что кошки в Лахоре могут быть носителями нового вида / штамма гемопаразита. Однако пока преждевременно говорить. Чтобы лучше понять это, мы должны нацелить больше генов с большим количеством ампликонов для секвенирования и филогенетического анализа. Насколько нам известно, в настоящем исследовании впервые была проведена ПЦР на Babesia felis в Пакистане, и благодаря своей большей чувствительности и специфичности ПЦР может быть рекомендована в качестве подтверждающего диагностического инструмента для обнаружения Babesia felis.

    Благодарности

    Это исследование финансировалось отделом паразитологии, UVAS, Пакистан.

    Конфликт интересов

    В этой статье нет конфликта интересов.

    Вклад авторов

    MYK и HA разработали исследование. MYK, RA и SI проводили эксперименты в лаборатории. WS и BZ провели статистический анализ.РА подготовил рукопись. Все авторы читают статью перед отправкой.

    Список литературы

  • • Ахмад С.С., Хан М.С., Хан М.А., Ахмад Н. (2011). Распространенность бабезиоза у кошек в Лахоре, Пакистан. ЯПС. 21: 354-357.
  • • Биркенхойер А.Дж., Леви М.Г., Брайчвердт Э.Б. (2003). Разработка и оценка семенной ПЦР для обнаружения и дифференциации Babesia gibsoni (азиатский генотип) и ДНК B. canis в образцах крови собак.JCM. 41: 4172-4177. https://doi.org/10.1128/JCM.41.9.4172-4177.2003
  • • Махарана Б.Р., Тевари А.К., Сараванан, Британская Колумбия, Судхакар, Северная Каролина (2016). Важные гемопротозойные болезни домашнего скота: проблемы современной диагностики и терапии: обновленная информация.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    © 2007–2021. При использовании материалов упоминание сайта «ЖИВОЙ УГОЛОК» обязательно
    custom footer text right
    Iconic One Theme | Powered by Wordpress