Глобулин витафел: Витафел для кошек: сыворотка, глобулин

Автор: | 30.08.1980

Содержание

Витафел С, Витакан С, Витафел глобулин, Глобулин Витакан

Витафел С сыворотка для кошек — препарат для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза.
Витакан С для собак — сыворотка для специфической профилактики и лечения чумы, парвовирусного энтерита и аденовирусной инфекции. 
Витафел глобулин для кошек — препарат для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза.
Глобулин Витакан — назначают собакам для специфической профилактики и лечения чумы, парвовирусного энтерита и аденовирусной инфекции.


Витафел С сыворотка для кошек — препарат для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза. По внешнему виду представляет собой прозрачную жидкость от бесцветного до коричневато-красного цвета. При хранении допускается образование осадка, который при встряхивании легко разбивается в равномерную взвесь.

Сыворотка Витафел — С представляет собой гомологичную сыворотку кошек-доноров, гипериммунизированных антигенами возбудителей панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза. 
Витафел — С назначают кошкам и другим животным семейства кошачьих для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза. 

Витакан С сыворотка для собак — сыворотка для специфической профилактики и лечения чумы, парвовирусного энтерита и аденовирусной инфекции. По внешнему виду представляет собой бесцветную или коричневатую жидкость. При хранении допускается образование осадка, который при встряхивании легко разбивается в равномерную взвесь.

Сыворотку Витакан-С изготавливают из крови собак-доноров, иммунизированных антигенами возбудителей чумы, парвовирусного энтерита и аденовирусной инфекции. Пассивный иммунитет у животных, обработанных с профилактической целью сывороткой Витакан-С, сохраняется не менее двух недель. 
Сыворотку Витакан-С назначают собакам для специфической профилактики и лечения чумы, парвовирусного энтерита и аденовирусной инфекции.

Витафел глобулин для кошек — препарат для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза. По внешнему виду представляет собой бесцветную или светло-желтую прозрачную, слегка опалесцирующую жидкость. При хранении допускается образование осадка, который при встряхивании легко разбивается в равномерную взвесь.

Глобулин Витафел содержит высокоочищенные гамма- и бета- глобулиновые фракции сыворотки крови кошек-доноров, гипериммунизированных антигенами возбудителей панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза.

Витафел глобулин назначают кошкам и другим животным семейства кошачьих для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза.

Глобулин Витакан — препрат для профилактики вирусных инфекций. По внешнему виду представляет собой бесцветную или светло-желтую прозрачную, слегка опалесцирующую жидкость.

Глобулин Витакан содержит комплекс гамма- и бета- глобулиновых фракций сыворотки крови собак-доноров, гипериммунизированных антигенами возбудителей чумы, парвовирусного энтерита и аденовирусной инфекции. 

Глобулин Витакан применяют для профилактики заражения чумой, парвовирусным энтеритом и аденовирусной инфекцией у непривитых животных глобулин Витакан применяют: в неблагополучных по указанным болезням питомниках для предотвращения заболевания клинически здоровых животных; перед посещением выставок и других массовых мероприятий, связанных с возможным контактом здоровых животных с больными; перед продажей или передачей щенков или взрослых животных в другие питомники для предотвращения их возможного заражения; перед вязкой невакцинированных собак; ощенившимся собакам в неблагополучных питомниках для создания прочного колострального (полученного с молоком) иммунитета у щенков; новорожденным щенкам, полученным от невакцинированных, а также подозрительных по заболеванию сук в неблагополучных питомниках.

ВИТАФЕЛ (глобулин)

ФАРМАКОЛОГИЧЕСКИЕ СВОЙСТВА

Пассивный иммунитет у животных, обработанных с профилактической целью глобулином Витафел, сохраняется не менее двух недель.

ПОКАЗАНИЯ

Назначают кошкам и другим животным семейства кошачьих для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза.

ДОЗЫ И СПОСОБ ПРИМЕНЕНИЯ

Для профилактики заражения панлейкопенией, инфекционным ринотрахеитом, калицивирозом и хламидиозом у непривитых домашних кошек и других животных семейства кошачьих глобулин Витафел применяют: в неблагополучных по указанным болезням питомниках для предотвращения заболевания клинически здоровых животных; перед посещением выставок и других массовых мероприятий, связанных с возможным контактом здоровых животных с больными; перед продажей или передачей котят или взрослых животных в другие питомники для предотвращения их возможного заражения; перед вязкой животных; окотившимся кошкам в неблагополучных питомниках для создания прочного колострального (полученного с молоком) иммунитета у котят; новорожденным котятам, полученным от непривитых, а также подозрительных по заболеванию кошек в неблагополучных питомниках. Для профилактики вирусных инфекций глобулин Витафел вводят животным подкожно в дозе 1 мл (1 доза) однократно или двукратно с интервалом 24 часа. По истечении срока формирования пассивного иммунитета для создания активного иммунитета проводят вакцинацию. С лечебной целью препарат применяют при подозрении в заражении указанными инфекциями. Наибольший терапевтический эффект достигается при применении препарата в начальной стадии болезни. Глобулин Витафел вводят животным подкожно в указанных дозах троекратно с интервалом 12 – 24 часа в зависимости от тяжести состояния животного. Возможно применение глобулина на фоне проведения симптоматического лечения, введения витаминов, антибиотиков и пробиотиков. При конъюнктивитах, вызванных герпесвирусами, калицивирусами и хламидиями, глобулин Витафел применяют в виде глазных капель: закапывание производят 2-3 раза в сутки по 1-3 капли в каждый глаз. При ринитах препарат закапывают в нос. Витафел глобулин может быть назначен животному независимо от его возраста и физиологического состояния (беременность, лактация и др.). При использовании глобулина Витафел необходимо соблюдать правила асептики и антисептики.

Глобулин Витафел содержит высокоочищенные гамма- и бета- глобулиновые фракции сыворотки крови кошек-доноров, гипериммунизированных антигенами возбудителей панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза. По внешнему виду представляет собой бесцветную или светло-желтую прозрачную, слегка опалесцирующую жидкость. При хранении допускается образование осадка, который при встряхивании легко разбивается в равномерную взвесь. Расфасовывают в ампулы по 1 мл (1 доза).

 

Витафел-С Противовирусная вакцина для лечения животных семейства кошачьих.

Опис

1. ОБЩИЕ ПОЛОЖЕНИЯ.
1.1. Препараты «Витафел» предназначены для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза животных семейства кошачьих.
1.2. Препараты являются иммуноглобулинами или сыворотками животных-доноров, иммунизированных антигенами возбудителей, высылающих указанные болезни. По внешнему виду иммуноглобулины представляют собой жидкость от бесцветного до красновато-коричневого цвета, сыворотки – от желтого до красно-коричневого цвета. При хранении допускается образование незначительного осадка, который при встряхивании легко разбивается.

Препараты выпускаются в виде:
– Иммуноглобулина «Витафел», представляющего собой гамма- и бета- глобулиновые фракции сыворотки крови гинериммунизированных кошек.
– Сыворотки «Витафел-С» – сыворотки гипериммунизированных кошек.
1.3. Препараты могут быть выпущены, как против одной или нескольких инфекций, так и против всех перечисленных. Если выпущенный препарат не содержит антител против какой-либо инфекции, то на этикетке указывают против каких возбудителей болезней они активны.
1.4. Препараты «Витафел» выпускаются расфасованными по 1,0 см1 (1 доза) в ампулах, которые должны быть запаяны, или флаконах, которые должны быть закрыты резиновыми пробками и обкатаны алюминиевыми колпачками.
1.5. При наличии в биопрепарате посторонних примесей, не разбивающихся хлопьев, плесени нарушении укупорки флакона или целости ампул, отсутствии этикетки, а также при истечении срока годности или не использовании в день вскрытия ампулы (флаконы) с препаратом подлежат утилизации, которая не требует специальных мер безопасности.
1.6. Препараты хранят в сухом, темном месте при температуре не выше 20 “С. Срок годности препаратов 2 года со дня изготовления.
2. БИОЛОГИЧЕСКИЕ СВОЙСТВА.
2.1. Пассивный иммунитет у животных, обработанных с профилактической целью препаратами «Витафел» или «Витафел-С» сохраняется не менее двух недель.
3. ПОРЯДОК ПРИМЕНЕНИЯ.
3.1. Препараты применяют для профилактики заражения панлейкопенией,
инфекционным ринотрахеитом, калицивирозом и хламидиозом у не привитых домашних кошек и других животных семейства кошачьих:
– в неблагополучных по указанным болезням питомникам для предотвращения заболевания клинически здоровых животных;
– перед посещениями выставок и других массовых мероприятий, связанных с возможным контактом здоровых животных с больными;
– перед продажей или передачей котят в другие питомники для предотвращения их возможного заражения;
– перед вязкой животных;
– окотившимся кошкам в неблагополучных питомниках для создания прочного коллострального (полученного с молоком) иммунитета у котят.
Для профилактики вирусных инфекций животным массой до 10 кг вводят 1,0 см1, свыше 10 кг – 2,0 см1 препарата однократно или двукратно с, интервалом 24 часа. По истечению срока формирования пассивного иммунитета (п.2.1.) для создания активного иммунитета проводят вакцинацию.
3.2. С лечебной целью препараты применяют при подозрении в заражении указанными инфекциями. Их вводят подкожно в указанных дозах 3-4 кратно с, интервалом 12-24 часа в зависимости от тяжести состояния животного. Допускается незначительная болезненность в момент инъецирования. Возможно применение глобулина и сыворотки на фойе проведения симптоматического лечения, введения витаминов, антибиотиков и пробиотиков.
При конъюнктивитах, вызванных герпес, калицивирусами и хламидиями глобулин «Витафел» кроме подкожного введения применяют в виде глазных капель: закапывание призводят 2-3 раза в сутки по 1-3 капли в каждый глаз. При ринитах гомологичный глобулин «Витафел» закапывают в нос.
Наибольший терапевтический эффект достигается при применении препаратов в начальных стадиях болезней.
3.3. Препараты «Витафел» и «Витафел-С» могут быть назначены животному независимо от его возраста и физиологического состояния (беременность, лактация и др.). Эти препараты не вызывают побочных реакций даже у высокопородных и изнеженных животных.
3.4. Противопоказаний к применению препаратов не выявлено.
При использовании препаратов (димедрола, супрастина, тавегила и т.д.) для предотвращения аллергических реакций.
3.5. При применении препаратов необходимо соблюдать правила асептики и антисептики.

Додаткова інформація

Витафел-С, 1 амп.(1 доза) х 1 мл

Инструкция по применению глобулина Витафел

Состав и форма выпуска
Глобулин Витафел содержит высокоочищенные гамма- и бета- глобулиновые фракции сыворотки крови кошек-доноров, гипериммунизированных антигенами возбудителей панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза. По внешнему виду представляет собой бесцветную или светло-желтую прозрачную, слегка опалесцирующую жидкость. При хранении допускается образование осадка, который при встряхивании легко разбивается в равномерную взвесь. Расфасовывают в ампулы по 1 мл (1 доза).

Фармакологические свойства
Пассивный иммунитет у животных, обработанных с профилактической целью глобулином Витафел, сохраняется не менее двух недель.

Показания
Назначают кошкам и другим животным семейства кошачьих для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза.

Дозы и способ применения
Для профилактики заражения панлейкопенией, инфекционным ринотрахеитом, калицивирозом и хламидиозом у непривитых домашних кошек и других животных семейства кошачьих глобулин Витафел применяют: в неблагополучных по указанным болезням питомниках для предотвращения заболевания клинически здоровых животных; перед посещением выставок и других массовых мероприятий, связанных с возможным контактом здоровых животных с больными; перед продажей или передачей котят или взрослых животных в другие питомники для предотвращения их возможного заражения; перед вязкой животных; окотившимся кошкам в неблагополучных питомниках для создания прочного колострального (полученного с молоком) иммунитета у котят; новорожденным котятам, полученным от непривитых, а также подозрительных по заболеванию кошек в неблагополучных питомниках. Для профилактики вирусных инфекций глобулин Витафел вводят животным подкожно в дозе 1 мл (1 доза) однократно или двукратно с интервалом 24 часа. По истечении срока формирования пассивного иммунитета для создания активного иммунитета проводят вакцинацию. С лечебной целью препарат применяют при подозрении в заражении указанными инфекциями. Наибольший терапевтический эффект достигается при применении препарата в начальной стадии болезни. Глобулин Витафел вводят животным подкожно в указанных дозах троекратно с интервалом 12 – 24 часа в зависимости от тяжести состояния животного. Возможно применение глобулина на фоне проведения симптоматического лечения, введения витаминов, антибиотиков и пробиотиков. При конъюнктивитах, вызванных герпесвирусами, калицивирусами и хламидиями, глобулин Витафел применяют в виде глазных капель: закапывание производят 2 – 3 раза в сутки по 1 – 3 капли в каждый глаз. При ринитах препарат закапывают в нос. Витафел глобулин может быть назначен животному независимо от его возраста и физиологического состояния (беременность, лактация и др.). При использовании глобулина Витафел необходимо соблюдать правила асептики и антисептики.

Побочные действия
Допускается незначительная болезненность в момент инъецирования глобулина. В редких случаях возможны аллергические реакции. При использовании глобулина Витафел для особо чувствительных животных с целью профилактики анафилаксии рекомендуется применение антигистаминных препаратов (димедрол, супрастин, тавегил) или дробного введения глобулина Витафел: вначале 0,5 мл, а затем, через 30 – 60 минут, оставшуюся дозу препарата.

Противопоказания
Выраженные аллергические реакции на предыдущее введение.

Особые указания
Особые меры предосторожности не предусмотрены. При попадании глобулина Витафел на кожу или слизистые оболочки рекомендуется промыть их водой. При наличии в препарате посторонних примесей, неразбивающихся хлопьев, плесени, нарушении целостности ампулы, отсутствии этикетки, а также при истечении срока годности или неиспользовании в день вскрытия ампулы с препаратом подлежат утилизации, которая не требует специальных мер безопасности.

Условия хранения
В сухом, защищенном от света, недоступном для детей и животных месте при температуре от 2 до 18 °С. Срок годности — 2 года.

Производитель: ЗАО НПБЦ «Линия Альба», Россия.

Упаковка: 10 ампул по 1 мл (10 доз)

Единица отпуска товара: 1 ампула 1 мл (1 доза)

Витакан и Витафел

Глобулин витафел

press to zoom

Глобулин витафел

press to zoom

ПРЕПАРАТ  ДВАЖДЫ  УДОСТОИН  ЗОЛОТОЙ  МЕДАЛИ  ВВЦ  (ВДНХ)  в  1993 и 1995гг.

Состав: высокоочищенные бета и гамма-глобулиновые фракции сыворотки крови животных-доноров (кошек), гипериммунизированные антигенами возбудителей панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза кошек. 

Препарат при введении в организм способствует формированию специфического иммунного ответа.

Пассивный иммунитет у кошек после введения с профилактической целью сыворотки  сохраняется не менее 2 недель. 

 

 

 

 

 

 

У ВАШЕЙ КОШКИ НЕДОМОГАНИЕ?

КАШЕЛЬ или ПОНОС?

ПРИМЕНИТЕ «ВИТАФЕЛ» — ОН ВЫЛЕЧИТ!

 

 

Против большинства вирусных болезней кошек поможет «ВИТАФЕЛ» — это специфический иммуноглобулин, содержащий защитные фракции глобулинов крови иммунизированных кошек.

          Кошачье происхождение препарата обеспечивает его хорошую переносимость и особо высокую активность при борьбе с болезнями именно этого вида животных.

          Препарат вводят подкожно с интервалом 12-24 часа одно-, двух-, либо трехкратно в зависимости от тяжести состояния животного. Улучшение состояния больных кошек наступает уже через 5-6 часов после первой инъекции препарата.

Всего одна инъекция препарата обережет Вашего непривитого питомца от заражения в момент перевозки или контакта с другими кошками. Длительность иммунитета — не менее 14 дней.

 

 

 

Форма выпуска:

— глобулин представляет собой бесцветную или слегка опалесцирующую жидкость;

— при хранении допускается образование незначительного осадка, разбивающегося при взбалтывании;

— препарат расфасован по 1 дозе (1,0 мл) в стеклянную ампулу;
— ампулы с глобулином упакованы в блистеры (коробки) по 10 штук, с приложением инструкции к применению;

— срок годности глобулина — 2 года, начиная с даты выпуска, при указанных условиях хранения. По истечении срока годности глобулин к применению не пригоден.

Показания:

— применяют для лечения панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза животных семейства кошачьих;

— при конъюнктивитах используют как глазные капли;

— применяют при рините для закапывания в нос;

— для профилактики назначают животному, независимо от его возраста и физиологического состояния (беременность, лактация и др.).

Рекомендации:

— для наибольшего терапевтического эффекта использовать препарат в начальной стадии болезни, соблюдая все нормы и дозировки, указанные в инструкции.

Преимущества глобулина при лечении:

— широкий спектр действия для основных вирусных заболеваний;

— эффективность и быстрота действия – эффект ощущается сразу после 1 инъекции;

— возможность применения одновременно с витаминами, антибиотиками, пробиотиками и другими препаратами, предназначенными для симптоматического лечения;

— отсутствие побочных эффектов, противопоказаний;

— возможность применения беременным, кормящим самкам, слабым животным;

— не вызывает побочных реакций даже у породистых и чувствительных кошек, в препарате нет составляющих, приводящих к образованию токсинов.

— возможность использования глобулина в виде капель для носа, глаз.

Для профилактики панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза животных семейства кошачьих глобулин применяется:

— в неблагополучных питомниках (по вышеуказанным болезням) для предотвращения заболевания здоровых кошек;

— перед посещением массовых мероприятий (например, выставок, выводок, различных cat-шоу), связанных с контактом здоровых кошек с больными;

— при продаже, передаче котят или взрослых кошек в питомники для предотвращения их заражения; 

— перед вязкой кошек;  

— окотившимся кошкам  в питомниках, неблагополучных по инфекционным болезням, для создания прочного колострального (полученного с молоком) иммунитета у котят.

Витафел

Состав и форма выпуска. Препараты витафел являются иммуноглобулинами или сыворотками животных-доноров, иммунизированных антигенами возбудителей панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза. По внешнему виду иммуноглобулины представляют собой бесцветную или светло-желтую, прозрачную, слегка опалесцирующую жидкость; сыворотки — желтую, прозрачную жидкость. При хранении препаратов допускается образование незначительного осадка, который при встряхивании легко разбивается.

Препараты выпускают в виде гомологичных:

Иммуноглобулина «Витафел», представляющего собой гамма- и бета- глобулиновые фракции сыворотки крови гипериммунизированных кошек.

Сыворотки «Витафел-С» — сыворотки гипериммунизированных кошек.

И гетерологичных:

Иммуноглобулина «Витафел Глоб», представляющего собой гамма- и бета- глобулиновые фракции сыворотки крови гипериммунизированных волов, лошадей, коз или свиней.

Сыворотки «Витафел-ГС» — сыворотки гипериммунизированных волов, лошадей, коз или свиней.

Препараты могут быть выпущены как против одной или нескольких инфекций, так и против всех перечисленных. Если выпущенный препарат не содержит антител против какой-либо инфекции, то на этикетке указывают против каких возбудителей болезней они активны.

Препараты «Витафел» выпускают расфасованными по 1 мл (1 доза) в ампулах или флаконах.

Фармакологическое действие. Пассивный иммунитет у животных, обработанных с профилактической целью гомологичными препаратами «Витафел» и «Витафел-С», сохраняется не менее двух недель; гетерологичными «Витафел Глоб» и «Витафел-ГС» — не менее недели.

Показания. Лечение и профилактика панлейкопении, инфекционного ринотрахеита, калицивироза и хламидиоза семейства кошачьих.

Дозы и способ применения. Для профилактики заражения панлейкопенией, инфекционным ринотрахеитом, калицивирозом и хламидиозом у непривитых домашних кошек и других животных семейства кошачьих:

  • в неблагополучных по указанным болезням питомниках для предотвращения заболевания клинически здоровых животных;
  • перед посещением выставок и других массовых мероприятий, связанных с возможным контактом здоровых животных с больными;
  • перед продажей или передачей котят в другие питомники для предотвращения их возможного заражения;
  • перед вязкой животных;
  • окотившимся кошкам в неблагополучных питомниках для создания прочного коллострального (полученного с молоком) иммунитета у котят

Для профилактики вирусных инфекций животным массой до 10 кг вводят 1 мл, свыше 10 кг — 2 мл препарата однократно или двукратно с интервалом 24 часа. По истечении срока пассивного иммунитета для создания активного иммунитета проводят вакцинацию.

С лечебной целью препараты применяют при подозрении в заражении указанными инфекциями. Их вводят подкожно в указанных дозах 3 — 4-кратно с интервалом 12 — 24 часа в зависимости от тяжести состояния животного. Возможно применение глобулина и сыворотки на фоне проведения симптоматического лечения, введения витаминов, антибиотиков и пробиотиков.

При конъюнктивитах, вызванных герпес, калицивирусами и хламидиями гомологичный глобулин «Витафел» кроме подкожного введения применяют в виде глазных капель: закапывание производят 2-3 раза в сутки по 1 — 3 капли в каждый глаз. При ринитах гомологичный глобулин «Витафел» закапывают в нос. Наибольший терапевтический эффект достигается при применении препаратов в начальной стадиях болезней.

Гомологичные препараты «Витафел» и «Витафел-С» могут быть назначены животному независимо от его возраста и физиологического состояния (беременность, лактация и др.). Гетерологичные препараты предпочтительнее применять животным старше 3 месяцев.

Побочные действия. Допускается незначительная болезненность в момент инъецирования. В редких случаях возможны аллергические реакции при использовании гетерологичных сывороток и иммуноглобулинов. Для предотвращения аллергических реакций рекомендуется назначать антигистаминные препараты (димедрол, супрастин, тавегил).

Противопоказания. Выраженные аллергические реакции на предыдущее введение.

Особые указания. При наличии в препарате посторонних примесей, неразбивающихся хлопьев, плесени, нарушении укупорки флакона или целостности ампул, отсутствии этикетки, а также при истечении срока годности или неиспользовании в день вскрытия ампулы (флаконы) с препаратом подлежат утилизации, которая не требует специальных мер безопасности.

Условия хранения. В сухом, темном месте при температуре не выше 20 °С. Срок годности — 2 года.

Производитель. БИОНИТ, Россия.

Линия Альба Витафел для профилактики и лечения панлейкопении (t)

В этом блоке мы рекомендуем разместить информацию о предлагаемых Вами товарах, подчеркнув их значимость и надежность.

Примечание. Обращаем Ваше внимание, что текстовая информация на сайте должна быть индивидуальной, не скопированной с других интернет-ресурсов, о чем указано в рекомендациях Яндекса: «Мы стараемся не индексировать или не ранжировать высоко сайты, копирующие информацию с других ресурсов и не создающие оригинального контента или сервиса».

Пример заполнения страницы:

Мы рады предложить вам широкий спектр услуг по … (Укажите предлагаемые услуги) по самым выгодным ценам.

или

Мы рады предложить вам широкий ассортимент … (Укажите предлагаемые товары) по самым выгодным ценам.

Вот уже … (Укажите стаж работы компании) лет наша компания занимает уверенные позиции на рынке и предоставляет только самые современные решения, позволяя нашим клиентам делать заказы через сайт.

За годы успешной работы компания … (Введите название компании) приобрела бесценный опыт, о чем свидетельствуют лестные отзывы наших клиентов.

Приобрести товары Вы сможете, обратившись к нам по указанным телефонам … (Укажите номер телефона) или воспользовавшись онлайн-консультантом на сайте.

В этом блоке мы рекомендуем разместить информацию о способах доставки.

Примечание. Обращаем Ваше внимание, что текстовая информация на сайте должна быть индивидуальной, не скопированной с других интернет-ресурсов, о чем указано в рекомендациях Яндекса: «Мы стараемся не индексировать или не ранжировать высоко сайты, копирующие информацию с других ресурсов и не создающие оригинального контента или сервиса».

В случае если у Вас возникли вопросы при оформлении заказа, Вы всегда можете обратиться в наш справочный центр по телефону … (Укажите номер телефона) или воспользовавшись онлайн-консультантом на сайте.

Витафель для кошек

Как известно, вирусы у домашних кошек вызывают сложные заболевания, которые часто приводят к гибели животного. Часто они передаются при прямом контакте с больной кошкой (вирусоносителем) или воздушно-капельным путем.

Поскольку терапия вирусных заболеваний направлена ​​на восстановление защиты слизистых оболочек, борьбу с вирусами и стимулирование иммунитета, без специальных иммунных препаратов здесь не обойтись.

Как одно из самых эффективных средств для лечения вирусных заболеваний зарекомендовали себя Витафель и Глобфель.

Витафел для кошек — заявка

Препарат назначают при заражении животного вирусной инфекцией, а именно панлейкопенией, калицивирусом, хламидиозом, ринотрахеитом. А что касается профилактики, в основном при смене жилья, перед вязкой, передачей или продажей котят, на выставках, в питомниках.

Выпускается компанией Витафель для кошек в виде прозрачных стеклянных ампул, объем — 1 мл, жидкость внутри — бесцветная, иногда имеет желтоватый оттенок.Если вы вдруг заметили, что на дне образовался осадок, не переживайте, это возможно при длительном хранении. Убрать его можно, если тщательно встряхнуть и размешать жидкость.

Глобулин Витафел для кошек создан гипериммунизацией кошек-доноров. То есть берут на эксперимент несколько кошек, заражают их ослабленными вирусами калицивироза, панлейкопении, ринотрахеита и хламидиоза, затем они легко заболевают, в результате чего их иммунная система формирует иммунный ответ в виде антител.Затем испытуемые берут кровь и готовят из нее глобулиновую фракцию.

Инструкция по применению сыворотки Витафел

Применяется в обязательном порядке при установлении диагноза или подозрении на заражение одним из вышеперечисленных вирусов. Для наилучшего лечебного эффекта Витафел глобулин для кошек лучше использовать на начальной стадии заболевания. Тогда лечение будет оправданным и максимально эффективным. Аналогично, параллельно с Витафелом рекомендуется употреблять витамины, иммуностимуляторы, противовирусные препараты, пробиотики и антибиотики.

Для профилактики инфекционных заболеваний кошкам до 10 кг вводят однократно в дозировке 1 мл (1 ампула), кошкам от 10 кг вводят дважды в день в дозировке 2 мл (2 ампулы), после чего: через 14 дней вакцинация.

Вызванный герпесвирусами, калицивирусами и хламидиозом конъюнктивит у кошек следует лечить следующим образом: 2 или 3 раза в день Витафел капают кошкам в каждый глаз по 1-3 капли. Все зависит от веса животного (котятам нужно меньше капель, кошкам весом более 4 кг — больше 2 капель).

Ринит следует лечить, переваривая 1-3 капли Витафел Глобулин для кошек в каждую ноздрю 2-3 раза в день.

Побочные действия препарата

В инструкции Витафеля для кошек указано, что единственно возможной реакцией на введение препарата является легкое болезненное ощущение в месте вакцинации и местная аллергическая реакция, но она легко исчезает после зуда или зуда. дифенгидрамин для инъекций. Согласно инструкции к сыворотке Витафел для кошек, при ее применении для профилактики особо чувствительных животных — Витафел-С может возникнуть анафилаксия, рекомендуется вводить сыворотку дробно: 0.Вначале 25 мл, а затем оставшуюся дозу препарата ввести через 30-60 минут.

Противопоказания к применению — выраженные аллергические реакции на предыдущие введения

Хранить Витафел только в холодильнике, при температуре 2-18 ° С и в темном месте.

Vitafel S сыворотка для кошек 1 мл — 5 ампул для инъекций

Витафель — препарат, положительно влияющий на организм животного. Препарат часто используется в ветеринарии и рекомендован многими специалистами.

Описание препарата

Препарат создан на основе сыворотки крови здоровых кошек. Препарат представляет собой прозрачную жидкость с характерным красноватым оттенком. В результате хранения на дне бутылки может образоваться осадок, который при встряхивании исчезает, образуя однородную массу.

Средство направлено на создание пассивного иммунитета, поэтому препарат часто рекомендуют использовать в профилактических целях. Временная защита тела длится около двух недель.

В большинстве случаев препарат назначают кошкам или другим животным этого семейства. Он активно борется с симптомами:

ринотрахеит;

хламидиоз;

панлейкопения;

калицивирус и др.

При лечении важно соблюдать правила дозирования и придерживаться определенного режима. Не пренебрегайте рекомендациями, которые представлены в инструкции или прописаны врачом.

Специалист имеет право вносить корректировки в допустимые нормы, исходя из особенностей животного.

Профилактические меры необходимы в неблагополучных питомниках перед предстоящей выставкой, где можно встретить зараженных животных перед вязкой.

В профилактических целях средство применяется в дозировке 1 мл на 10 кг массы тела. Если запад животного превышает желаемые значения, вы можете удвоить ставку.

Во время лечения необходимо вакцинировать трижды с интервалом в сутки между инъекциями.

Препарат можно назначать параллельно с антибиотиками, витаминами и другими средствами.

Сыворотка может быть назначена животным любого возраста, беременным кошачьим, кормящим также можно лечить.

Можно предварительно дать животному антигистаминный препарат. Побочных реакций замечено не было. Исключением является индивидуальная непереносимость компонентов в составе препарата.

Причины выбора

Цена на Витафель доступная и полностью оправданная. Не беспокойтесь о самочувствии животного в период лечения. Вакцина не оказывает негативного воздействия на питомца и не вызывает побочных реакций.

Купить Витафель можно на сайте. Здесь представлена ​​только качественная продукция.

Сыворотка Витафел-С — гомологичная сыворотка донорских кошек, гипериммунизированных антигенами возбудителей панлейкопении, инфекционного ринотрахеита, калицивируса и хламидиоза. По внешнему виду это прозрачная жидкость от бесцветного до коричневато-красного цвета. При хранении допускается образование осадка, который при встряхивании легко распадается на однородную суспензию. Расфасован в ампулы по 1 мл (1 доза).

Фармакологические свойства:

Пассивный иммунитет у животных, получавших сыворотку Vitafel-C с профилактической целью, сохраняется не менее двух недель.

Показания:

Назначен кошкам и другим животным из семейства кошачьих для специфической профилактики и лечения панлейкопении, инфекционного ринотрахеита, калицивируса и хламидиоза.

Дозы и способ применения:

Для профилактики заражения панлейкопенией, инфекционным ринотрахеитом, калицивирусом и хламидиозом у невакцинированных домашних кошек и других представителей семейства кошачьих используется сыворотка Витафел-С:

— в неблагополучных по указанным заболеваниям питомниках для профилактики болезней клинически здоровых животных;

перед посещением выставок и других массовых мероприятий, связанных с возможным контактом здоровых животных с больными животными;

— перед продажей или передачей котят или взрослых животных в другие питомники для предотвращения их возможного заражения;

— перед вязкими животными; окот кошек в неблагополучных питомниках для создания у котят сильного молозивного (молочного) иммунитета.

Для профилактики вирусных инфекций сыворотку Витафел-С животным вводят подкожно в следующих дозах:

с животным массой до 10 кг — 1 мл (1 доза) сыворотки,

с животным массой более 10 кг — 2 мл (2 дозы) сыворотки дважды с интервалом 24 часа.

По истечении срока формирования пассивного иммунитета проводится вакцинация для создания активного иммунитета.

В лечебных целях сыворотку Витафел-С применяют при подозрении на заражение указанными инфекциями.

Наибольший терапевтический эффект достигается при применении препарата в начальной стадии заболевания.

Сыворотка Витафел-С вводят животным подкожно в указанных дозах трижды с интервалом от 12 до 24 часов, в зависимости от тяжести состояния животного.

Возможно применение сыворотки на фоне симптоматического лечения, введения витаминов, антибиотиков и пробиотиков.

Лечебно-профилактическая сыворотка Витафел-С может быть назначена животному независимо от его возраста и физиологического состояния (беременность, период лактации и др.)). При использовании сыворотки Витафел-С необходимо соблюдать правила асептики и антисептики.

Допускается легкая болезненность во время инъекции сыворотки. В редких случаях возможны аллергические реакции. При применении сыворотки Витафел-С для особо чувствительных животных для профилактики анафилаксии рекомендуется применение антигистаминных препаратов (дифенгидрамин, супрастин, тавегил) или дробное введение сыворотки Витафел-С: сначала 0,25 мл, а затем, через 30-60 минут. , оставшаяся доза препарата.

Противопоказания:

Тяжелые аллергические реакции на предыдущий прием.

Особые указания:

Никаких особых мер предосторожности не предпринимается. При попадании сыворотки Vitafel-S на кожу или слизистые оболочки рекомендуется промыть их водой. При наличии в составе препарата примесей, небьющихся хлопьев, плесени, нарушения целостности ампулы, отсутствия этикетки, а также срока годности или неиспользования в день вскрытия ампула с препаратом должна утилизировать, что не требует специальных мер безопасности.

Условия хранения:

Хранить в сухом, защищенном от света месте, недоступном для детей и животных, при температуре от 2 до 18 ° С. Срок годности — 2 года.

новый, функциональный и сильно дивергентный глобулин, связывающий половые гормоны, который может участвовать в местном контроле функций яичников у лососевых | Эндокринология

Была идентифицирована и охарактеризована кДНК, кодирующая новый SHBG радужной форели. Филогенетический анализ показал, что этот новый SHBG, названный SHBGb, был сильно дивергентным паралогом классической формы SHBG (SHBGa), ранее известной у позвоночных, включая рыбок данио, морского окуня и радужную форель.Используя все доступные последовательности, нельзя было идентифицировать SHBGb-подобную последовательность ни у одного вида рыб, кроме атлантического лосося. SHBGa и SHBGb радужной форели имеют только 26% идентичность последовательностей на уровне аминокислот и демонстрируют полностью различное тканевое распределение, демонстрируя, таким образом, функциональный сдвиг SHBGb. Действительно, мРНК shbga преимущественно экспрессируется в печени и селезенке, но не может быть обнаружена в яичнике, тогда как shbgb имеет преобладающую экспрессию в яичниках, но не может быть обнаружена в печени.Несмотря на высокую дивергенцию, SHBGb радужной форели, экспрессируемый в клетках COS-7, может связывать эстрадиол и тестостерон с высокой аффинностью и специфичностью. Как мРНК радужной форели shbgb , так и белки были локализованы в клетках гранулезы вителлогенных фолликулов яичников, тогда как иммунореактивность SHBGb также была обнаружена в клетках теки. Наконец, экспрессия мРНК яичников shbgb демонстрирует значительное падение между поздним вителлогенезом и созреванием ооцитов в то время, когда экспрессия гена яичниковой ароматазы ( cyp19a ) и уровни циркулирующего эстрадиола демонстрируют резкое снижение.Вместе эти наблюдения показывают, что SHBGb является функциональным и сильно дивергентным паралогом SHBG, вероятно, возникающим из-за специфической для лососевых рыб дупликации гена shbg .

SHBG ЯВЛЯЕТСЯ БЕЛКОМ-НОСИТЕЛЕМ, в основном секретируемым печенью в кровь, где он связывает половые стероиды с высоким сродством (1, 2). Согласно гипотезе свободных гормонов (3), эти половые стероиды будут оставаться неактивными за счет связывания с SHBG в плазме, что приводит к предположению, что только фракция стероидов, свободных от SHBG, останется доступной для диффузии через клеточные мембраны и опосредования действия стероидов. .Однако некоторые данные также предполагают, что эти белки могут опосредовать сигнал половых стероидов непосредственно после связывания с мембранно-ассоциированными белками и запуска последующего ответа цАМФ (4). Это предположение было частично предположено при характеристике некоторых внепеченочных участков экспрессии SHBG , поддерживающих в этих стероидных тканях-мишенях влияние SHBG на местное действие стероидов (5). Среди этих тканей экспрессия SHBG была обнаружена в яичках (6), простате (5), кистах груди (7) и яичниках (8, 9), где этот белок, как предполагается, действует как локальный регулятор функций тканей и органов.

Белки SHBG были биохимически охарактеризованы в крови многих различных видов позвоночных, включая низших позвоночных, т.е. . рептилии (10), земноводные (11) и рыбы (12). У рыб описана характеристика генов shbg у рыбок данио, Danio rerio (13) и европейского морского окуня, Dicentrarchus labrax (14, 15). Эти рыбы shbg имеют много общих черт со своими ортологами млекопитающих, включая некоторую консервацию аминокислот в ключевых остатках, важных для связывания стероидов, преобладающую экспрессию в печени (13, 15) и высокую аффинность связывания с половыми стероидами.Они также обладают некоторыми особыми характеристиками, такими как важная экспрессия рыбок данио shbg в кишечнике (13) или высокое сродство морского окуня shbg к синтетическому эстрогену 17α-этинилэстрадиолу (14).

Радужная форель, Oncorhynchus mykiss , является одним из наиболее изученных видов рыб с долгой историей исследований, проводимых в области физиологии, питания, экологии, генетики, патологии, канцерогенеза и токсикологии (16). В дополнение к дупликации всего генома рыбы (17), радужная форель, как и все лососевые, также претерпела дополнительную дупликацию всего генома 25–100 миллионов лет назад (18), что дало возможность изучить недавнюю судьбу вновь дуплицированных генов.По сравнению с другими модельными рыбами радужная форель имеет большие размеры тела и медленное развитие, что дает интересные возможности для одновременного проведения биохимических, молекулярных и физиологических исследований. Кроме того, у этого вида теперь доступны все большие геномные ресурсы (19, 20). Используя профили экспрессии микроматрицы кДНК, мы недавно идентифицировали ранее не охарактеризованный ген яичников, демонстрирующий чрезвычайно хорошую корреляцию с временным профилем экспрессии ароматазы ( cyp19a ) (21).Используя частичную аминокислотную последовательность, этот ген был первоначально автоматически аннотирован как белок S (также известный как витамин K-зависимый белок) на основе кластеризации нескольких тегов экспрессируемой последовательности (EST), доступных в общедоступных базах данных. Однако значительная идентичность последовательностей наблюдалась и с другими белками, включая SHBG. В настоящей работе мы даем функциональное и физиологическое описание этого нового гена, который мы охарактеризовали как сильно дивергентный, но все же функциональный SHBG, который может участвовать в локальном контроле функций яичников у лососевых.

Материалы и методы

Коллекция животных и тканей

Исследования проводились в соответствии с руководящими принципами использования лабораторных животных и ухода за ними и в соответствии с французскими и европейскими правилами защиты животных. Радужная форель ( O. mykiss ) из осенне-нерестового штамма была получена с экспериментального рыбоводного хозяйства (Сизун, Франция) примерно за 1 месяц до нереста. Рыбу держали и отбирали пробы, как описано ранее (22).Образцы из яичников брали во время позднего вителлогенеза (3–4 недели до ожидаемого нереста, n = 6), после вителлогенеза (до созревания ооцитов, но в период нереста, n = 6) и во время созревания ооцитов (n = 6). Для сбора тканей форель подвергали глубокой анестезии в 2-феноксиэтаноле (1 мл / литр воды), убивали ударом по голове и обескровливали срез жаберной дуги. Аликвоты яичников либо замораживали в жидком азоте и хранили при -80 ° C до экстракции РНК, либо фиксировали в фиксаторе Дитрика (10% формальдегид, 28.5% этанола, 2% ледяной уксусной кислоты в воде) при 4 ° C в течение ночи, промывали в водопроводной воде в течение 1 ч и выдерживали в 50% этаноле. Для исследования распределения тканей у трех поствителлогенных самок брали пробы различных тканей и объединяли перед RT. Образцы семенников были также получены от трех разных самцов на стадии II (начало сперматогенеза только с сперматогониями A и B) (23) и объединены перед RT.

Регулирование in vitro эстрадиолом в фолликулах яичников

фрагментов яичников было отобрано у трех самок радужной форели во время раннего вителлогенеза (гонадосоматический индекс = 0.5%) в стерильных условиях. Фрагменты яичников инкубировали при 12 ° C в 12-луночных культуральных планшетах при соотношении 100 мг / мл среды для инкубации IM8 / 300 [133 мМ NaCl, 3,09 мМ KCl, 0,28 мМ MgSO 4 , 2,1 мМ MgCl 2 , 4,5 мМ CaCl 2 , 5,6 мМ глюкозы, 20 мМ HEPES (pH 8,0), 300 мОсм]. Для каждой самки три фрагмента яичников инкубировали в присутствии 40 нМ эстрадиола, а три фрагмента яичников инкубировали только в минеральной среде и использовали в качестве отрицательного контроля. После 20 ч инкубации фрагменты яичников замораживали в жидком азоте и хранили при -80 ° C до экстракции РНК.

Анализ последовательности

Клоны кДНК tcbk0006.j.01 и tcay0036.n.19, соответствующие радужной форели shbgb и происходящие из программы INRA-Agenae (20), были полностью секвенированы в обоих направлениях, как описано ранее (22). Прогнозирование потенциального сигнального пептида, N -гликозилирования и сайтов фосфорилирования выполняли с использованием серверов прогнозирования Центра анализа биологических последовательностей (www.cbs.dtu.dk) на основе выведенной аминокислотной последовательности.Множественные выравнивания аминокислотных последовательностей были построены с использованием программного обеспечения ClustalW.

Филогенетический анализ

Мы выполнили филогенетический анализ с помощью конвейера филогеномного анализа, доступного на платформе FIGENIX (http://www.up.univ-mrs.fr/evol/figenix/) (24). FIGENIX извлек последовательности, обеспечил множественное выравнивание последовательностей, выполнил филогенетическую реконструкцию и установил отношения ортологии и паралогии (подробное описание используемых конвейеров и моделей см.24). Частичная последовательность shbgb , выведенная из некоторых EST атлантического лосося ( Salmo salar ) (инвентарные номера GenBank DY735728, DY694623, DY719210, DW561629, DY699232, CK884863, CA056042, DY699233, были введены в задачу phference и DY699233), который был запущен с параметрами по умолчанию и с базами данных Ensembl и NCBI-NR. Мы выбрали топологию NJ (соединение соседей) для графического представления. Результирующее дерево (npl) представляет собой объединение деревьев соединения соседей (25), максимальной экономии и максимального правдоподобия (26).Матрица Dayhoff PAM предоставила матрицу расстояний для метода NJ. Последовательности, разделяющие эволюционное расстояние, определяются как количество мутационных событий на сайт, лежащих в основе разделяющих эволюционную историю последовательностей. Таким образом, эволюционные отношения между последовательностями представлены древовидной структурой, где длина ветви представляет собой эволюционное расстояние (26, 27). На рис. 1 для каждого узла указаны значения начальной загрузки для каждого метода npl. Начальная загрузка производилась с использованием 1000 повторений.

Рис. 1.

Филогения семейств белков SHBG / PROS1 / GAS6 у позвоночных, включая рыб. Значения начальной загрузки для методов соединения соседей, максимальной экономии и максимального правдоподобия соответственно указываются на узлах каждой ветви для оценки их надежности. Консенсусное дерево было рассчитано с помощью автоматизированного конвейера филогеномной аннотации FIGENIX с частичной белковой последовательностью S. salar (*) shbgb , использованной в качестве приманки (подробности см. В «Материалы и методы »).Номера последовательностей белков для каждого вида даны под скобками справа от рисунка . Масштабная линейка представляет количество изменений на позицию и на единицу длины ответвления.

Рис. 1.

Филогения семейств белков SHBG / PROS1 / GAS6 у позвоночных, включая рыб. Значения начальной загрузки для методов соединения соседей, максимальной экономии и максимального правдоподобия соответственно указываются на узлах каждой ветви для оценки их надежности.Консенсусное дерево было рассчитано с помощью автоматизированного конвейера филогеномной аннотации FIGENIX с частичной белковой последовательностью S. salar (*) shbgb , использованной в качестве приманки (подробности см. В «Материалы и методы »). Номера последовательностей белков для каждого вида даны под скобками справа от рисунка . Масштабная линейка представляет количество изменений на позицию и на единицу длины ответвления.

Анализ ПЦР в реальном времени

ПЦР в реальном времени выполняли с использованием I-Cycler IQ (Bio-Rad, Hercules, CA), как описано ранее (28).Контрольные реакции проводили без обратной транскриптазы. Продукты RT, включая контрольные реакции, разбавляли до 1/25, и 5 мкл использовали для каждой ПЦР в реальном времени. Для каждого продукта RT проводили трижды. ПЦР в реальном времени выполняли с использованием набора для ПЦР в реальном времени, снабженного флуорофором SYBR Green (Eurogentec, Seraing, Бельгия) с 600 нм каждого праймера. Были использованы следующие праймеры: shbga (CCCATTCTGGAACTTTGAGG / ACACCCCATAACCTGGTCAA) и shbgb (ACATGTGGGGGGATGTTCATT / GAGGCCATGTTACGGTTTTG).Относительное количество целевой кДНК в наборе образцов рассчитывали из пула серийно разведенных кДНК (стандартная кривая) с использованием программного обеспечения I-Cycler IQ. После амплификации была получена кривая слияния для подтверждения амплификации одного продукта ПЦР. Перед дальнейшим анализом данные ПЦР в реальном времени были нормализованы с использованием количества транскриптов 18S в образцах. Контрольные реакции использовали для расчета фонового уровня экспрессии для каждого гена для идентификации тканей, демонстрирующих уровни экспрессии, значительно превышающие фон.

Гибридизация in situ и иммуноцитохимия

Обработку ткани яичника проводили, как описано ранее (29). Вкратце, обезвоживание и парафиновую инфильтрацию проводили в тканевом процессоре Citadel 1000 (Shandon, Pittsburgh, PA). Обезвоженные ткани помещали в пластиковые формы в парафине с использованием HistoEmbedder (TBS88; Medite, Burgdorf, Германия). In situ Гибридизацию и иммуноцитохимию проводили с использованием роботизированной станции In situ Pro, Intavis AG. In situ Гибридизацию проводили, как описано ранее, с небольшими модификациями (30). Антитело, направленное против SHBGb радужной форели, было создано Eurogentec. Два пептида SHBGb радужной форели (CRQDSSILERTLQDSK и CTDGDYELLKRVLSQP), которые не обнаруживаются в SHBGa радужной форели, одновременно использовали для иммунизации кроликов. ELISA был проведен для обоих пептидов, чтобы выбрать пептид, который дал лучший ответ. Затем полученную антисыворотку дополнительно очищали иммуноаффинностью против следующего пептида: CRQDSSILERTLQDSK.Для иммуноцитохимии очищенное антитело SHBGb разбавляли до 1: 100 и выявляли с использованием антитела, связанного с флуоресцеина изотиоцианатом.

Выражение shbgb радужной форели в клетках COS-7

Клетки COS-7 поддерживали в среде DMEM с высокой концентрацией глюкозы (Sigma Chemical Co., Сент-Луис, Миссури) с добавлением 10% фетальной бычьей сыворотки (FBS) (Roche Diagnostics, Мангейм, Германия), 2 ммл-глутамина, и антибиотик. Клетки выращивали в атмосфере 5% CO 2 и 95% воздуха при 37 ° C.Продукт ПЦР, включающий полную открытую рамку считывания shbgb , вставляли в вектор экспрессии pCMV (Stratagene, La Jolla, CA). Полученную плазмиду использовали для трансфекции субконфлюэнтных клеток COS-7 (60-80% конфлюэнтности) с использованием реагента Fugene HD (Roche Diagnostics) в соответствии с протоколом производителя. Для трансфекции использовали соотношение реагента к ДНК 8: 2. Через шесть часов после трансфекции культуральную среду удаляли. Затем клетки дважды промывали PBS для удаления FBS и затем культивировали в течение 48 ч в 4 раза.5 г / л глюкозы DMEM без красного фенола и FBS. Через 48 ч культуральную среду, содержащую рекомбинантный белок, собирали для дальнейшего анализа.

Анализы связывания стероидов

Немеченые стероиды были получены от Steraloids (Ньюпорт, Род-Айленд). [2,4,6,7- 3 H] Эстрадиол-17β (E2) (3,40 ТБк / ммоль), [1,2,6,7- 3 H] тестостерон (T) (3,59 ТБк / ммоль) ) и [2,4,6,7- 3 H] кортизол (F) (2,55 ТБ / ммоль) были приобретены в GE Healthcare Europe Gmbh (Сакле, Франция).Среду для культивирования клеток COS-7 центрифугировали (3500 × g в течение 15 мин) и замораживали при -20 ° C перед дальнейшим анализом. Меченный тритием тестостерон, эстрадиол-17β и связывание F искали в трансфицированных клетках COS-7, используя метод Taylor et al . (31). Никакого специфического связывания не было обнаружено ни для одного из протестированных стероидов (данные не показаны), и дополнительные эксперименты были выполнены только на культуральной среде.

Каждый образец анализировали в трех экземплярах. Аликвоты среды для культивирования клеток COS-7 (200 мкл) инкубировали в 5-миллилитровых стеклянных пробирках с меченными тритием стероидами (в 100 мкл DMEM добавляли 0.1% желатина) в конечной концентрации 5 нМ в присутствии (неспецифическое связывание) или в отсутствие (полное связывание) 500-кратного избытка радиоактивного стероида (2,5 мкм) в течение 16 ч при 4 ° С.

Культуральную среду инкубировали при 4 ° C в течение времени от 30 секунд до 8 часов для определения скорости ассоциации 5 нм [ 3 H] T. Скорость его диссоциации определяли путем инкубации культуральной среды при 4 ° C с 5 нм [ 3 H] T с последующим добавлением 500-кратного избытка немеченого конкурента в течение времени от 30 секунд до 8 часов.В каждом случае неспецифическое связывание оценивали инкубацией в присутствии 2,5 мкМ радиоактивного стероида. Анализы конкурентного связывания выполняли путем фиксации возрастающих концентраций (от 0,5 нм до 5 мкм) немеченого конкурента (E2, T, 11-кетотестостерон, 17-гидроксипрогестерон, F, 2-метоксиэстрадиол и 5α-дигидротестостерон) в начале инкубации.

Инкубации останавливали добавлением 200 мкл раствора угля, покрытого ледяным декстраном (DCC) [2,5% древесного угля и 0,25% декстрана в 50 мМ фосфатном буфере (pH 7.4) с 0,1% желатином]. Пробирки быстро встряхивали и инкубировали на льду в течение 5 минут перед центрифугированием при 2000 × g и 4 ° C в течение 7 минут. Аликвоты супернатанта (400 мкл) добавляли к 4 мл Picofluor 40 (PerkinElmer, Бостон, Массачусетс) для подсчета радиоактивности (эффективность 32%).

Результаты выражены в виде средних значений ± стандартное отклонение, а константа равновесной диссоциации (K d ) была определена с помощью анализа Скэтчарда.

Результаты

Последовательность и филогенетический анализ

КДНК радужной форели shbgb (GenBank EF577269) имела длину 1797 п.н. с открытой рамкой считывания, кодирующей белок из 412 аминокислот (GenBank ABQ45411).После выполнения анализа BLAST выведенная последовательность белка имела значительное сходство с остановкой роста позвоночных 6 (GAS6), витамин k-зависимым предшественником белка S (PROS1) и SHBG. Филогенетический анализ ясно показал, что этот белок принадлежит к ветви SHBG, на что указывают значимые значения начальной загрузки (рис. 1). В рамках этой ветви белок SHBGb был четко отделен от SHBG всех видов позвоночных, включая радужную форель. Таким образом, описанный в настоящем исследовании белок считался паралогом SHBG радужной форели и поэтому был назван β-формой SHBG (SHBGb) в соответствии с существующей номенклатурой генов.Соответственно, ранее описанный классический белок SHBG радужной форели в тексте будет называться SHBGa радужной форели. За исключением EST атлантического лосося ( S. salar ) (см. «Материалы и методы» ), ни у одного вида позвоночных, включая виды рыб с полными последовательностями генома, нельзя было обнаружить родственную последовательность SHBGb. В филогенетическом анализе (рис. 1) последовательность лосося была сгруппирована с последовательностью SHBGb радужной форели с очень значимыми значениями начальной загрузки.

Последовательность белка SHBGb радужной форели продемонстрировала 26% идентичности последовательности с SHBGa радужной форели, 29% с SHBG рыбок данио и 29% с SHBG морского окуня. Сходные степени идентичности последовательностей (28, 27 и 28%) были также обнаружены между последовательностями SHBGb радужной форели и крысы ( Rattus norvegicus ), кролика ( Oryctolagus cuniculus ) и SHBG человека соответственно (рис.2). . Кроме того, SHBGb радужной форели также демонстрирует значительное сходство последовательностей с белками GAS6 и PROS1 позвоночных, как ранее сообщалось для SHBG (32, 33).Последовательность SHBGb радужной форели содержала четыре остатка цистеина в положениях 191, 217, 375 и 402, которые являются консервативными среди всех последовательностей SHBG позвоночных (рис. 2). Эти остатки цистеина позволяют образовывать дисульфидные мостики внутри двух ламининовых G-подобных доменов, обнаруженных в положениях 57–197 и 255–377. N-концевой мембранный рецептор-связывающий домен (34) является одним из наиболее консервативных доменов во всех белках SHBG, и этот участок из 10 аминокислот также является наиболее консервативной частью SHBGb с восемью остатками, идентичными последовательности человека ( Инжир.2). Остаток серина в положении 42 (Ser42) зрелого белка SHBG человека, который обнаруживается во всех последовательностях SHBG рыб, включая последовательность SHBGa радужной форели, также присутствует в последовательности SHBGb радужной форели. Напротив, остаток аспарагиновой кислоты в положении 65 (Asp65) человеческого SHBG не консервативен в SHBGb радужной форели. В SHBG человека эти два остатка связываются с функциональными группами C3 и C17 половых стероидов, которые связывают SHBG с высоким сродством (35, 36). Интересно, что остаток Asn82 млекопитающих SHBG, который участвует в различении некоторых связанных стероидов (35), заменяется лизином в SHBG у всех видов рыб, включая SHBGa форели, тогда как он заменяется на цистеин в SHBGb форели.Последовательность SHBGb радужной форели обнаруживает три предсказанных N -гликозилированных сайта в положениях 48, 102 и 243, которые не консервативны в других последовательностях SHBG рыб (14).

Рис. 2.

Сравнение аминокислотной последовательности у радужной форели SHBGb, радужной форели SHBGa (BAE48779 O . mykiss ), SHBG рыбок данио (NP_001007152 D . reriabass

3G (AA reriabass

3G), se labrax ), крысиный ГСПГ (NP_036782 R . norvegicus ), SHBG кролика (NP_001075839 O . cuniculus ) и SHBG человека (AAC18778 H . sapiens ). Остатки цистеина, которые образуют внутримолекулярные дисульфидные мостики внутри двух ламинин-G-подобных (LG) доменов и остатков Ser42 и Asp65, обозначены стрелкой . Аминокислоты, соответствующие сигнальному пептиду SHBGb радужной форели, представляют собой , подчеркнутые . Три сайта N -гликозилирования в последовательности SHBGb радужной форели отмечены звездочками .N-концевой мембранный рецептор-связывающий домен (34), консервативный в белках SHBG, имеет значение , заключенное в рамку, .

Рис. 2.

Сравнение аминокислотных последовательностей радужной форели SHBGb, радужной форели SHBGa (BAE48779 O . mykiss ), SHBG рыбок данио (NP_001007152 D . rerio8ass . labrax ), SHBG крысы (NP_036782 R . norvegicus ), SHBG кролика (NP_001075839 O . cuniculus ) и SHBG человека (AAC18778 H . sapiens ). Остатки цистеина, которые образуют внутримолекулярные дисульфидные мостики внутри двух ламинин-G-подобных (LG) доменов и остатков Ser42 и Asp65, обозначены стрелкой . Аминокислоты, соответствующие сигнальному пептиду SHBGb радужной форели, представляют собой , подчеркнутые . Три сайта N -гликозилирования в последовательности SHBGb радужной форели отмечены звездочками . N-концевой мембранный рецептор-связывающий домен (34), консервативный в белках SHBG, имеет значение , заключенное в рамку, .

Распределение тканей и профили экспрессии в яичнике

Исследование экспрессии ПЦР в реальном времени, проведенное с использованием 14 различных тканей, показало, что транскрипт радужной форели shbgb сильно и преимущественно экспрессируется в яичниках. Он также был обнаружен на гораздо более низких уровнях в мышцах и желудке, но не мог быть значительно обнаружен в каких-либо других исследованных тканях, включая печень (рис. 3A). Напротив, транскрипт shbga сильно и преимущественно экспрессируется в печени и селезенке.Он также присутствовал в низких, но значительных количествах в жабрах, гипофизе и желудке (рис. 3B).

Рис. 3.

Тканевая экспрессия радужной форели транскриптов shbga (A) и shbgb (B). ПЦР-анализ в реальном времени проводился с использованием общей РНК, происходящей из следующих тканей, взятых у трех разных рыб: мозг (Br), гипофиз (Pi), жабры (Gi), сердце (He), печень (Li), селезенка (Sp). , желудок (St), кишечник (In), головная почка (HK), ствол почки (TK), мышца (Mu), кожа (Sk), пост-вителлогенный яичник (Ov) и яичко II стадии (Te).Для каждой ткани проводили три отдельные реакции RT с использованием отдельных образцов РНК, полученных от трех разных рыб. Реакции RT объединяли и использовали для проведения ПЦР в реальном времени в трех повторностях. Показаны среднее и стандартное отклонение (n = 3). #, Уровни экспрессии существенно не отличаются от фонового сигнала при P <0,05. Для обоих генов одна единица оси ординат соответствует уровню экспрессии shbgb в яичнике.

Рис. 3.

Тканевая экспрессия радужной форели транскриптов shbga (A) и shbgb (B).ПЦР-анализ в реальном времени проводился с использованием общей РНК, происходящей из следующих тканей, взятых у трех разных рыб: мозг (Br), гипофиз (Pi), жабры (Gi), сердце (He), печень (Li), селезенка (Sp). , желудок (St), кишечник (In), головная почка (HK), ствол почки (TK), мышца (Mu), кожа (Sk), пост-вителлогенный яичник (Ov) и яичко II стадии (Te). Для каждой ткани проводили три отдельные реакции RT с использованием отдельных образцов РНК, полученных от трех разных рыб. Реакции RT объединяли и использовали для проведения ПЦР в реальном времени в трех повторностях.Показаны среднее и стандартное отклонение (n = 3). #, Уровни экспрессии существенно не отличаются от фонового сигнала при P <0,05. Для обоих генов одна единица оси ординат соответствует уровню экспрессии shbgb в яичнике.

В преовуляторном яичнике shbgb обнаруживает заметную понижающую регуляцию перед возобновлением мейоза. Интересно, что очень похожий профиль экспрессии наблюдался для ароматазы яичников ( cyp19a ) (рис. 4).

Рис.4.

Профили экспрессии в яичниках радужной форели cyp19a и shbgb во время позднего вителлогенеза, пост-вителлогенеза и созревания ооцитов. Во время пост-вителлогенеза образцы собирали во время или после миграции зародышевого пузырька (GV) на периферию ооцита. Во время созревания ооцитов образцы собирали во время и после разрушения зародышевых пузырьков (GVBD). Уровни экспрессии обоих генов контролировали с помощью ПЦР в реальном времени в образцах РНК, полученных от отдельных самок.Для каждого гена данные экспрессии были стандартизированы с использованием 18S, а затем центрированы по медиане. Для каждого гена уровни мРНК выражены в процентах от уровня экспрессии в образце, демонстрирующем наивысшую экспрессию. Для каждого образца показаны средние значения (± стандартное отклонение) трехкратной ПЦР.

Рис. 4.

Профили экспрессии в яичниках радужной форели cyp19a и shbgb во время позднего вителлогенеза, пост-вителлогенеза и созревания ооцитов. Во время пост-вителлогенеза образцы собирали во время или после миграции зародышевого пузырька (GV) на периферию ооцита.Во время созревания ооцитов образцы собирали во время и после разрушения зародышевых пузырьков (GVBD). Уровни экспрессии обоих генов контролировали с помощью ПЦР в реальном времени в образцах РНК, полученных от отдельных самок. Для каждого гена данные экспрессии были стандартизированы с использованием 18S, а затем центрированы по медиане. Для каждого гена уровни мРНК выражены в процентах от уровня экспрессии в образце, демонстрирующем наивысшую экспрессию. Для каждого образца показаны средние значения (± стандартное отклонение) трехкратной ПЦР.

Регулирование эстрадиолом in vitro

Инкубация in vitro показала, что экспрессия shbgb была выше в группе, обработанной E2, чем в контрольной группе (фиг. 5), даже несмотря на то, что эта разница не была значимой у одной из исследованных самок.

Рис. 5.

In vitro регуляция экспрессии shbgb во фрагментах яичников, подвергнутых воздействию 40 нм E2 в этанольном носителе в течение 20 часов.Контрольные инкубации соответствуют одной минеральной среде с добавлением этанола. Каждый эксперимент (Опыт) соответствует разной самке. Для каждого эксперимента инкубации проводили в трех экземплярах как для контроля, так и для обработки E2. РНК экстрагировали из каждой лунки индивидуальной культуры и использовали для ОТ и дальнейшей ПЦР в реальном времени. Для каждого эксперимента экспрессию shbgb стандартизировали с использованием 18S и затем нормализовали до экспрессии в контрольной группе. *, Значимые различия между контрольной и обработанной E2 группами при P <0.05.

Рис. 5.

In vitro регуляция экспрессии shbgb во фрагментах яичников, подвергнутых воздействию 40 нм E2 в этаноле-носителе в течение 20 часов. Контрольные инкубации соответствуют одной минеральной среде с добавлением этанола. Каждый эксперимент (Опыт) соответствует разной самке. Для каждого эксперимента инкубации проводили в трех экземплярах как для контроля, так и для обработки E2. РНК экстрагировали из каждой лунки индивидуальной культуры и использовали для ОТ и дальнейшей ПЦР в реальном времени.Для каждого эксперимента экспрессию shbgb стандартизировали с использованием 18S и затем нормализовали до экспрессии в контрольной группе. * Значимые различия между контрольной и обработанной E2 группами при P <0,05.

Сотовая локализация

В ткани яичников радужной форели транскрипт shbgb был локализован в вителлогенных фолликулах гранулезных клеток (рис. 6). Кроме того, исследование иммунолокализации показало, что белок SHBGb присутствует как в гранулезных, так и в тека-клетках вителлогенных фолликулов (рис.7).

Рис. 6.

Локализация in situ транскриптов cyp19a и shbgb в клетках гранулезы фолликулов яичников радужной форели. Антисмысловые (AS) и смысловые (S) зонды гибридизовали на соседних участках. A и B, Транскрипт shbgb присутствовал в клетках гранулезы (gr) средневителлогенных (A) и поздних вителлогенных (B) фолликулов, но не в клетках тека (th) и ооцитах (oo). Также указывается радиальная зона (zr) ооцита.C. Аналогичный паттерн экспрессии транскрипта cyp19a наблюдался в фолликулах с поздним вителлогением.

Рис. 6.

Локализация in situ транскриптов cyp19a и shbgb в клетках гранулезы фолликулов яичников радужной форели. Антисмысловые (AS) и смысловые (S) зонды гибридизовали на соседних участках. A и B, Транскрипт shbgb присутствовал в клетках гранулезы (gr) средневителлогенных (A) и поздних вителлогенных (B) фолликулов, но не в клетках тека (th) и ооцитах (oo).Также указывается радиальная зона (zr) ооцита. C. Аналогичный паттерн экспрессии транскрипта cyp19a наблюдался в фолликулах с поздним вителлогением.

Рис. 7.

Иммунодетекция SHBGb в поздних вителлогенных фолликулах. Белок был обнаружен в клетках granulosa (gr) и theca (th), но не в zona radiate (zr) или ooplasm (oo).

Рис. 7.

Иммунодетекция SHBGb в поздних вителлогенных фолликулах. Белок был обнаружен в клетках granulosa (gr) и theca (th), но не в zona radiate (zr) или ooplasm (oo).

Биохимический анализ радужной форели SHBGb

[ 3 H] T- и [ 3 H] E2-специфическое связывание было обнаружено в культуральной среде клеток COS-7, трансфицированных SHBGb, тогда как связывание не могло быть обнаружено для [ 3 H] F ( Рис. 8A). Анализ насыщения и график Скэтчарда показали наличие высокоаффинного (K d = 0,77 нм; 95% доверительный интервал 0,71–0,83) насыщаемого единственного сайта связывания для [ 3 H] T (фиг. 8B). Кинетика ассоциации и диссоциации [ 3 H] T была быстрой, при этом 50% максимального связывания достигалось через 3–4 мин (рис.8, В и Г). Кажущаяся константа скорости диссоциации составила 0,43 мин -1 (95% доверительный интервал 0,42-0,45). Анализы конкурентного связывания с T показали, что E2 и T имеют сходное сродство, тогда как 2-метоксиэстрадиол имеет более низкое сродство (таблица 1). Напротив, 11-кетотестостерон и 5α-дигидротестостерон конкурировали на низком уровне, тогда как 17-гидроксипрогестерон и F показали незначительную конкуренцию (Таблица 1).

Рис. 8.

Связывающие характеристики рекомбинантной радужной форели SHBGb.Метод DCC-адсорбции использовался для разделения свободных и связанных фракций, и показано только специфическое связывание [Bs = общее связывание (T) — неспецифическое связывание]. A, связывание [ 3 H] E2, [ 3 H] T и [ 3 H] F, измеренное в культуральной среде клеток COS-7, трансфицированных SHBG; 5 нМ каждого меченного тритием стероида инкубировали в течение 16 ч при 4 ° C в отсутствие (полное связывание) или в присутствии (неспецифическое связывание) 500-кратного соответствующего радиоактивного стероида (среднее ± стандартное отклонение, n = 3). Культуральную среду клеток COS-7, трансфицированных вектором экспрессии pCMV, использовали в качестве отрицательного контроля.B. Анализ Скэтчарда связывания [ 3 H] T. Аликвоты среды для культивирования клеток COS инкубировали при 4 ° C с возрастающей концентрацией [ 3 H] T в отсутствие или в присутствии 500 × радиоинертных T перед добавлением DCC. Каждая точка графика Скэтчарда рассчитывается на основе трех измерений общего и неспецифического связывания. Пунктирные линии представляют 95% доверительный интервал регрессии. C, скорость ассоциации [ 3 H] T; 5 нм [ 3 H] T инкубировали при 4 ° C с аликвотами среды для культивирования клеток COS, с 500-кратным избытком радиоактивного Т или без него, в течение от 30 секунд до 8 часов перед добавлением DCC (данные выражены в процентах от максимальной специфической связывание; означает ± SD, n = 3).D, скорость диссоциации [ 3 H] T; 5 нм [ 3 H] T инкубировали при 4 ° C в течение 16 ч с аликвотами среды для культивирования клеток COS-7 в отсутствие или в присутствии 500 × радиоинертных T. Диссоциацию индуцировали добавлением 500 × радиоинертных T и анализ прекращается с помощью DCC после 30 секунд — 8 ч инкубации (данные выражены в процентах от максимального связывания; среднее значение ± стандартное отклонение, n = 3). E — Общее, специфическое и неспецифическое связывание тестостерона в культуральной среде клеток COS-7, экспрессирующих SHBGb радужной форели.

Рис. 8.

Связывающие характеристики рекомбинантной радужной форели SHBGb. Метод DCC-адсорбции использовался для разделения свободных и связанных фракций, и показано только специфическое связывание [Bs = общее связывание (T) — неспецифическое связывание]. A, связывание [ 3 H] E2, [ 3 H] T и [ 3 H] F, измеренное в культуральной среде клеток COS-7, трансфицированных SHBG; 5 нМ каждого меченного тритием стероида инкубировали в течение 16 ч при 4 ° C в отсутствие (полное связывание) или в присутствии (неспецифическое связывание) 500-кратного соответствующего радиоактивного стероида (среднее ± стандартное отклонение, n = 3).Культуральную среду клеток COS-7, трансфицированных вектором экспрессии pCMV, использовали в качестве отрицательного контроля. B. Анализ Скэтчарда связывания [ 3 H] T. Аликвоты среды для культивирования клеток COS инкубировали при 4 ° C с возрастающей концентрацией [ 3 H] T в отсутствие или в присутствии 500 × радиоинертных T перед добавлением DCC. Каждая точка графика Скэтчарда рассчитывается на основе трех измерений общего и неспецифического связывания. Пунктирные линии представляют 95% доверительный интервал регрессии.C, скорость ассоциации [ 3 H] T; 5 нм [ 3 H] T инкубировали при 4 ° C с аликвотами среды для культивирования клеток COS, с 500-кратным избытком радиоактивного Т или без него, в течение от 30 секунд до 8 часов перед добавлением DCC (данные выражены в процентах от максимальной специфической связывание; означает ± SD, n = 3). D, скорость диссоциации [ 3 H] T; 5 нм [ 3 H] T инкубировали при 4 ° C в течение 16 ч с аликвотами среды для культивирования клеток COS-7 в отсутствие или в присутствии 500 × радиоинертных T. Диссоциацию индуцировали добавлением 500 × радиоинертных T и анализ прекращается с помощью DCC после 30 секунд — 8 ч инкубации (данные выражены в процентах от максимального связывания; среднее значение ± стандартное отклонение, n = 3).E — Общее, специфическое и неспецифическое связывание тестостерона в культуральной среде клеток COS-7, экспрессирующих SHBGb радужной форели.

Таблица 1. Относительное сродство связывания

различных стероидов для радужной форели SHBGb

Стероид . Относительная аффинность связывания .
T 100
E2 100
2-метоксиэстрадиол 26
11-кетогидотестостерон
11-кетотестостерон
17-гидроксипрогестерон 0.1
F 0,1
Стероид . Относительная аффинность связывания .
T 100
E2 100
2-метоксиэстрадиол 26
11-кетогидотестостерон
11-кетотестостерон
17-гидроксипрогестерон 0.1
F 0,1
Таблица 1.

Относительное сродство связывания различных стероидов для радужной форели SHBGb

Стероид . Относительная аффинность связывания .
T 100
E2 100
2-метоксиэстрадиол 26
11-кетогидотестостерон
11-кетотестостерон
17-гидроксипрогестерон 0.1
F 0,1
Стероид . Относительная аффинность связывания .
T 100
E2 100
2-метоксиэстрадиол 26
11-кетогидотестостерон
11-кетотестостерон
17-гидроксипрогестерон 0.1
F 0.1

Обсуждение

SHBGb: сильно дивергентный паралог SHBG, ограниченный лососевыми

Дупликации всего генома считаются решающим событием для эволюции видов (37), и эта гипотеза широко изучалась на рыбах с плавниками, у которых произошел дополнительный раунд дупликации генома (17). В этом отношении новый ген радужной форели shbgb , о котором здесь сообщается, весьма интригует.Основываясь на своем филогенетическом положении, которое разветвляется в корне всех классических четвероногих SHBG, эта последовательность, без какой-либо двусмысленности, является новым членом семейства SHBG позвоночных. Однако, кроме некоторых EST атлантического лосося, мы не смогли найти какой-либо другой ортологичный аналог shbgb в пределах линии лучевых плавников, даже у видов с полными последовательностями генома (, например, . Данио и фугу). Это убедительно свидетельствует о том, что этот ген shbgb является паралогом радужной форели, который возник в результате специфической для лососей дополнительной дупликации генома (18).Однако эта паралогия не поддерживается полученной топологией дерева консенсуса. Это несоответствие может быть объяснено артефактом притяжения длинной ветви (38), возникающим в результате резкого расхождения этой последовательности. Такая высокая скорость молекулярной эволюции, по-видимому, довольно часта для многих генов, возникающих в результате дупликации генома рыб, и эти дублированные гены часто связаны с функциональными сдвигами в результате суб- или неофункционализации (39). Дупликация генов также может иногда приводить к потере функции гена (псевдогенизации).Основываясь на огромном расхождении этого нового гена, функциональность радужной форели SHBGb не была очевидна и ее пришлось продемонстрировать экспериментально. Однако, несмотря на высокую дивергенцию, SHBGb радужной форели все же демонстрирует некоторые консервативные черты, типичные для всех SHBG позвоночных. Действительно, сохранение тандемных повторов ламинин-G-подобных доменов, которые имеют решающее значение для связывания стероидов и образования димеров, или N-концевого аминокислотного участка, который связывается с мембранным рецептором SHBG (34), предполагает в целом хорошую структурную консервативность, потенциально указывает на некоторую сохраненную функциональность.Однако по крайней мере один ключевой остаток (человеческий Asp65), который имеет решающее значение для высокоаффинных взаимодействий по C3 и C17 некоторых стероидов (36) и консервативный во всех других белках SHBG, больше не присутствует в последовательности SHBGb радужной форели, что позволяет предположить также некоторые функциональные различия в аффинности связывания стероидов у SHBGb радужной форели. Чтобы использовать эту расходящуюся последовательность для сравнительного анализа структуры и функции, необходимо получить больше структурной информации. Это можно разработать либо с помощью подходов к моделированию in silico, с использованием уже доступной кристаллической структуры стероид-связывающего сайта человека SHBG (40), либо путем разрешения частичной кристаллической структуры для этого нового SHBG.

Радужная форель SHBGb, функциональный стероид-связывающий белок

Циркулирующие SHGB были обнаружены в плазме многих видов рыб (12, 41–45), включая лососевых. Для радужной форели сообщалось о значениях K d , составляющих 2,6 нм для T и 2,1–16,8 нм для E2 (12, 46–48). Исследования связывания показали, что SHBG присутствует в печени форели (47, 49, 50) и семенниках (51). В конкурентных анализах против [ 3 H] T, E2 показал более низкое сродство, чем T, тогда как T и E2 показали аналогичное сродство в конкурентных анализах против [ 3 H] E2.В целом эти данные указывают на несколько более высокое сродство SHBGa радужной форели к T, чем к E2. Для сравнения, SHBGb показал более высокое сродство к [ 3 H] T (K d = 0,77 нм), чем SHBGa, и E2 в равной степени конкурировал с T против [ 3 H] T. Также следует отметить, что, как и классическая форма SHBG (13, 14, 51), SHBGb радужной форели имеет низкую аффинность связывания с 11-кетотестостероном. Однако, в отличие от классической формы SHBG у рыбок данио и морского окуня, SHBGb радужной форели был способен связывать 2-метоксиэстрадиол, но не 5α-дигидротестостерон (13, 14).В совокупности наши наблюдения демонстрируют, что, несмотря на большое расхождение последовательностей с классическими белками SHBG, SHBGb радужной форели является функциональным и имеет сходное сродство к эстрадиолу и тестостерону. Однако необходимы дополнительные исследования, чтобы лучше различать стероид-связывающие характеристики двух SHBG радужной форели. Данные о SHBGa были получены в исследованиях, проведенных на плазме, которая также содержит другие связывающие белки, такие как альбумин и кортикостероид-связывающий глобулин (46), тогда как наша работа была проведена с использованием рекомбинантного SHBGb.Было бы полезно сравнить два рекомбинантных белка. Кроме того, ввиду некоторых различий в аминокислотных последовательностях между SHBGa и SHBGb, в конкурентных анализах следует проверять большее количество стероидов. Этот сильно расходящийся SHBGb представляет собой хорошую модель для таких исследований, направленных на изучение эволюции связывания половых стероидов.

Субфункционализация генов SHBG у лососевых

У млекопитающих SHBG сначала рассматривался как переносчик стероидов плазмы, продуцируемый печенью и участвующий в высвобождении стероидов в тканях-мишенях (2).Согласно гипотезе свободных гормонов (3), стероиды проникают в клетки путем пассивной диффузии через плазматическую мембрану после диссоциации от их белков-носителей, что может регулировать их биодоступность. Однако появляется все больше доказательств других функций SHBG, поддерживаемых взаимодействием с рецепторами на клеточных мембранах и интернализацией SHBG (52–56). Это локальное действие на органы-мишени часто было связано с локальной экспрессией SHBG в нескольких тканях, включая яичник (5, 8, 9).Поэтому представляется весьма вероятным, что в дополнение к классической функции носителя / доставки стероидов, SHBG также выполняет другие функции в органах-мишенях, включая яичники. Сильная экспрессия радужной форели shbga в печени, наблюдаемая в настоящем исследовании, полностью согласуется с данными многочисленных исследований на млекопитающих (57–59) и рыбах (13, 15). Напротив, мРНК радужной форели shbgb преимущественно экспрессировалась в яичнике, но не могла быть обнаружена в печени, даже несмотря на то, что использовался чувствительный метод обнаружения.У позвоночных данные об экспрессии SHBG в яичнике немногочисленны. Однако кажется очевидным, что SHBG экспрессируется в клетках гранулезы фолликула яичника человека (8). Напротив, экспрессия shbg не может быть обнаружена у рыбок данио ( Danio rerio ) и морского окуня ( Dicentrarchus labrax ) во время оогенеза (13, 15). Однако слабый иммуногистохимический сигнал для SHBG был обнаружен в соединительной ткани морского окуня вокруг незрелого яичника и некоторых поствителлогенных фолликулах, но это было связано с кровяным происхождением (15).В настоящем исследовании мы четко показали, что SHBGb радужной форели локально синтезируется в слое гранулез позднего вителлогенного фолликула яичника радужной форели. Эта локальная экспрессия, наряду с отсутствием экспрессии в печени, полностью согласуется с гипотезой о событии дупликации гена у лососевых, за которым следует быстрая эволюция паралога shbgb и его последующая субфункционализация, характеризующаяся по крайней мере определенным паттерном тканевой экспрессии. .

Доказательства участия SHBGb в эстрогенном контроле функций яичников в яичнике форели

У млекопитающих SHBG-подобное связывание было обнаружено в фолликулярной жидкости яичников овцы и человека (60–63).Первоначально предполагалось, что SHBG может локально регулировать биодоступность эстрадиола и андрогенов в яичниках. Однако было подчеркнуто, что большое количество E2 в преовуляторных фолликулах человека превышает связывающую способность для SHBG, и казалось маловероятным, что SHBG регулирует биодоступность эстрогена в фолликулярной жидкости (61). Кроме того, аналогичные уровни SHBG, обнаруженные в крови и фолликулярной жидкости, исключают, что SHBG отвечает за поддержание градиента концентрации эстрадиола от фолликула к плазме (60).В совокупности данные, доступные у млекопитающих, убедительно свидетельствуют о том, что SHBG выполняет специфическую функцию в яичниках, которая не связана строго с его буферной способностью для стероидов.

Используя профили экспрессии генов микроматрицы кДНК, мы ранее показали, что радужная форель shbgb и ароматаза яичников ( cyp19a ) демонстрируют высококоррелированные профили экспрессии генов яичников во время окончательного созревания ооцитов (21). В настоящем исследовании эти наблюдения были подтверждены количественной ПЦР.Интересно, что ограниченная повышающая регуляция shbgb с помощью E2 наблюдалась in vitro во время раннего вителлогенеза, периода, когда уровни циркулирующего E2 увеличиваются in vivo . Однако стоит отметить, что это повышение регуляции оказалось весьма различным среди женщин и не всегда значительным. В совокупности эти наблюдения согласуются с гипотезой о ко-регуляции shbgb и cyp19a в яичнике радужной форели. Кроме того, как SHBGb, так и cyp19a синтезируются в клетках гранулезы позднего вителлогенного фолликула.Таким образом, shbgb и cyp19a пространственно и временно коэкспрессируются во время позднего вителлогенеза, пост-вителлогенеза и созревания ооцитов. Экспрессия shbgb высока во время позднего вителлогенеза, до созревания ооцитов, в то время, когда активность ароматазы и уровни эстрадиола также высоки. Такая высокая экспрессия в клетках гранулез пост-вителлогенных фолликулов яичников у видов, не обладающих антральным отделом (65), согласуется с обнаружением SHBG в фолликулярной жидкости развивающихся доминантных фолликулов млекопитающих в то время, когда активность ароматазы и уровни эстрадиола находятся на уровне также высокий (66).Уменьшение экспрессии генов радужной форели shbgb и cyp19a происходит в то время, когда уровни циркулирующего E2 и активность ароматазы резко падают, а уровни андростендиона и тестостерона повышаются (64, 67). Вместе эти наблюдения, наряду с преобладающей экспрессией SHBGb в яичниках, предполагают, что SHBGb участвует в действии эстрогенов и / или андрогенов в яичниках. Основываясь на существующей литературе о млекопитающих, SHBGb может либо действовать, регулируя биодоступность эстрогенов и / или андрогенов в фолликуле яичника, либо активно участвовать в действии эстрогенов и / или андрогенов на фолликулярные клетки.

Благодарности

Эти данные о последовательностях были переданы в базу данных GenBank под номером доступа. EF577269.

Текущий адрес D.V .: Facultad de Ciencias, Oceanología, Iguá 4225, Montevideo 11400, Uruguay.

Заявление о раскрытии информации: авторам нечего раскрывать.

Сокращения

  • DCC

  • E2

  • EST

  • F

  • FBS

  • GAS6

  • предшественник витамина

    витамин

1

Selby

C

1990

Глобулин, связывающий половые гормоны: происхождение, функция и клиническое значение

.Ann Clin Biochem

27

(

Pt 6

):

532

541

2

Siiteri

PK

,

Murai

JT

,

Hammond

GL

,

Raymoure

WJ

,

Kuhn

RW

1982

Транспортировка стероидных гормонов в сыворотке крови.

Recent Prog Horm Res

38

:

457

510

3

Mendel

CM

1989

Гипотеза свободных гормонов: математическая модель, основанная на физиологии.

Endocr Ред.

10

:

232

274

4

Кан

SM

,

Hryb

DJ

,

Nakhla

AM

000

000 ROS W

2002

Глобулин, связывающий половые гормоны, синтезируется в клетках-мишенях.

J Endocrinol

175

:

113

120

5

Hryb

DJ

,

Nakhla

AM

,

Kahn

SM

000

St George

,

St George

NC

,

Romas

NA

,

Rosner

W

2002

Глобулин, связывающий половые гормоны, в простате человека синтезируется локально и может действовать как аутокринный / паракринный эффектор.

J Biol Chem

277

:

26618

26622

6

Selva

DM

,

Hammond

GL

2006

Половые клетки человека экспрессируются в тесте связывания половых гормонов человека не в клетках Сертоли.

Horm Metab Res

38

:

230

235

7

Rosner

W

,

Khan

MS

,

Breed

CN

Fleisher

HL

1985

Стероидсвязывающие белки плазмы в кистах при макрокистозной болезни груди.

J Clin Endocrinol Metab

61

:

200

203

8

Кузницы

T

,

Gerard

A

,

Hess

Bar Monnier

,

Bar

,

Bar

Gerard

H

2004

Экспрессия глобулина, связывающего половые гормоны (SHBG), в гранулезо-лютеиновых клетках человека.

Mol Cell Endocrinol

219

:

61

68

9

Forges

T

,

Gerard

A

,

Monnier-Barbarino

P

P

2005

Иммунолокализация глобулина, связывающего половые гормоны (ГСПГ) в фолликулах яичников и желтом теле человека.

Histochem Cell Biol

124

:

285

290

10

Salhanick

AC

,

Callard

IP

1980

Пресноводный белок в плазме, связывающий половые стероиды черепаха, Chrysemys picta .

Gen Comp Endocrinol

42

:

163

166

11

Paolucci

M

,

Di Fiore

MM

1994

Половые стероиды связывающие белки в плазме крови, связывающие половые стероиды Rana esculenta : изменения во время репродуктивного цикла и зависимость от гипофиза и гонад.

Gen Comp Endocrinol

96

:

401

411

12

Hobby

AC

,

Geraghty

DP

,

Характеристики Pankhurst

Пол

NW

стероид-связывающий белок у репродуктивных и непродуктивных самок радужной форели ( Oncorhynchus mykiss ), черного леща ( Acanthopagrus butcheri ) и камбалы ( Rhombosolea tapirina ).

Gen Comp Endocrinol

120

:

249

259

13

Miguel-Queralt

S

,

Knowlton

M

,

Avvakumov

Avvakumov

Kelly

GM

,

Hammond

GL

2004

Молекулярная и функциональная характеристика глобулина, связывающего половые гормоны, у рыбок данио.

Эндокринология

145

:

5221

5230

14

Miguel-Queralt

S

,

Avvakumov

GV

,

Blazquez

000

Miguel-Queralt

Miguel-Queralt

GL

2005

Морской окунь ( Dicentrarchus labrax ) глобулин, связывающий половые гормоны: молекулярные и биохимические свойства и филогенетическое сравнение его ортологов у нескольких видов рыб.

Эндокринол Mol Cell

229

:

21

29

15

Miguel-Queralt

S

,

Blazquez

M

,

Piferrer

000 F20003

F2000 2007

Экспрессия глобулина, связывающего половые гормоны, у морского окуня ( Dicentrarchus labrax L .) На протяжении всего развития и репродуктивного сезона.

Эндокринол клеток Mol

276

:

55

62

16

Thorgaard

GH

,

Bailey

GS

,

Williams

D

DR

DR

D

DR

SL

,

Ristow

SS

,

Hansen

JD

,

Winton

JR

,

Bartholomew

JL

,

Nagler

0003

9J2000 Pagler

9J2000

9J2000 MM

,

Devlin

RH

,

Hardy

RW

,

Overturf

KE

,

Young

WP

,

Robison

BD

,

Rexroad

2002

Состояние и возможности геномных исследований радужной форели.

Comp Biochem Physiol B Biochem Mol Biol

133

:

609

646

17

Meyer

A

,

Van de

PY

2005 От 20003 до

дупликация специфического генома рыб (FSGD).

Bioessays

27

:

937

945

18

Allendorf

FW

,

Thorgaard

GH

1984

Тетраплоидия и эволюция лососевых рыб.В:

Turner

BJ

, ed. Эволюционная генетика рыб.

Нью-Йорк

:

Пленум Пресс

;

1

53

19

Rexroad

CE

,

Lee

Y

,

Keele

JW

,

Карамычева

S

,

Kapo

Коричневый

K ,

Gahr

SA

,

Palti

Y

,

Quackenbush

J

2003

Анализ последовательности кДНК библиотеки радужной форели и создание генного индекса.

Cytogenet Genome Res

102

:

347

354

20

Govoroun

M

,

Le Gac

F

,

2006 Guiguen

большой репертуар экспрессируемых тегов последовательностей (EST) из нормализованных библиотек кДНК радужной форели.

BMC Genomics

7

:

196

21

Bobe

J

,

Montfort

J

,

Nguyen

T

,

Fostier

Новые участники Fostier

у радужной форели ( Oncorhynchus mykiss ) процессы созревания и овуляции ооцитов с использованием микрочипов кДНК.

Reprod Biol Endocrinol

4

:

39

22

Kamangar

BB

,

Gabillard

JC

,

Bobe

J

2006

J

2006 9000 связывающий фактор роста ) -1, -2, -3, -4, -5 и -6 и IGFBP-родственный белок 1 во время поствителлогенеза радужной форели и созревания ооцитов: молекулярная характеристика, профили экспрессии и гормональная регуляция.

Эндокринология

147

:

2399

2410

23

Billard

R

1992

Размножение радужной форели: дифференциация полов, динамика гаметогенеза, биология дичи и сохранение дичи.

Аквакультура

100

:

263

298

24

Гуре

P

,

Vitiello

V

,

Balandraud

N

000 P

000

000 P

000 P

,

Danchin

EG

2005

FIGENIX: интеллектуальная автоматизация геномной аннотации: интеграция опыта в новую программную платформу.

BMC Bioinformatics

6

:

198

25

Saitou

N

,

Nei

M

1987

Метод объединения соседей: новый метод реконструкции филогенетических деревьев.

Mol Biol Evol

4

:

406

425

26

Felsenstein

J

1981

Эволюционные деревья из последовательностей ДНК: подход максимального правдоподобия.

J Mol Evol

17

:

368

376

27

Nei

M

1996

Филогенетический анализ в молекулярной эволюционной генетике.

Annu Rev Genet

30

:

371

403

28

Bobe

J

,

Nguyen

T

,

Jalabert

B

радужная форель ( Oncorhynchus mykiss ) яичник во время приобретения компетентности и созревания ооцитов.

Biol Reprod

71

:

73

82

29

Mourot

B

,

Nguyen

T

,

Fostier

A

Два неродственных предполагаемых мембраносвязанных рецептора прогестина, компонент 1 мембранного рецептора прогестерона (PGMRC1) и мембранный рецептор прогестина (mPR) β, экспрессируются в ооцитах радужной форели и демонстрируют сходные паттерны экспрессии в яичниках.

Репрод Биол Эндокринол

4

:

6

30

Вицциано

D

,

Рандуинол

G

,

Барон

D

,

000

000

Cauty

000

0002

2007

Характеристика ранней молекулярной дифференциации пола у радужной форели, Oncorhynchus mykiss .

Dev Dyn

236

:

2198

2206

31

Taylor

CM

,

Blanchard

B

,

Zava

DT

1984

метод определения ячеек

поглощение радиоактивно меченных эстрогенов и прогестерона и их субклеточная локализация в линиях клеток рака молочной железы в монослойной культуре.

J Steroid Biochem

20

:

1083

1088

32

Joseph

DR

,

Baker

ME

1992

Связывающий половые гормоны и глобулин, связывающий половые гормоны, и глобулин, связывающий половые гормоны К-зависимый белок S гомологичен ламинину А, мерозину и белку Drosophila crumbs.

FASEB J

6

:

2477

2481

33

Joseph

DR

1997

Последовательность и функциональные отношения между андроген-связывающим белком / глобулином, связывающим половые гормоны, и его гомологами Газ6, ламинин и агрин.

Стероиды

62

:

578

588

34

Хан

MS

,

Hryb

DJ

,

Hashim

GA

,

000

1990

Выделение и синтез мембранного рецептор-связывающего домена глобулина, связывающего половые гормоны.

J Biol Chem

265

:

18362

18365

35

Аввакумов

GV

,

Гришковская

I

,

Muller

Y

,

Muller

Y

,

Muller

Y

Кристаллическая структура глобулина, связывающего половые гормоны человека в комплексе с 2-метоксиэстрадиолом, раскрывает молекулярную основу высокоаффинных взаимодействий с С-2 производными эстрадиола.

J Biol Chem

277

:

45219

45225

36

Гришковская

I

,

Аввакумов

GV

,

Catalyst

MG

Hammond GL

YA

2002

Стероидные лиганды связывают глобулин, связывающий половые гормоны человека, в определенных ориентациях и вызывают отчетливые изменения в конформации белка.

J Biol Chem

277

:

32086

32093

37

Оно

S

1999

Дублирование генов и уникальность геномов позвоночных примерно 1970–1999 гг.

Semin Cell Dev Biol

10

:

517

522

38

Delsuc

F

,

Brinkmann

H

,

Philippe

H

9 дерево жизни.

Nat Rev Genet

6

:

361

375

39

Steinke

D

,

Salzburger

W

,

Braasch

I

0003

Многие гены рыб имеют видоспецифичную асимметричную скорость молекулярной эволюции.

BMC Genomics

7

:

20

40

Гришковская

I

,

Аввакумов

GV

,

Sklenar

G

000

000

Dales 9000

000

Dales

Muller

YA

2000

Кристаллическая структура глобулина, связывающего половые гормоны человека: транспорт стероидов G-подобным доменом ламинина.

EMBO J

19

:

504

512

41

Chang

CF

,

Lee

YH

1992

Очистка общего белка Cyprus, связывающего половые стероиды карпио ) плазма.

Comp Biochem Physiol B

101

:

587

590

42

Corvol

P

,

Bardin

CW

1973

Связывание тестостерона.

Biol Reprod

8

:

277

282

43

Freeman

HC

,

Idler

DR

1971

Сродство гормонов крови кортикостероидов к половым гормонам и сродство кортикостероидов рыб.

Стероиды

17

:

233

250

44

Лейдли

CW

,

Томас

P

1997

Изменения в плазме крови, рецидивирующей ово-стероид-связывающий белок пятнистая форель ( Cynoscion nebulosus ).

Biol Reprod

56

:

931

937

45

Pasmanik

M

,

Callard

G

1986

Глобуловое связывание золотистой рыбки с TE .

Biol Reprod

35

:

838

845

46

Fostier

A

,

Breton

B

1975

Привязка стероидов радуги плазмой 9013 Salmo gairdneri .

J Steroid Biochem

6

:

345

351

47

Pottinger

TG

,

Пикеринг

AD

1990

Связывание с плазмой и введение эстрада на кортизол у неполовозрелых самок радужной форели ( Oncorhynchus mykiss ).

Gen Comp Endocrinol

80

:

264

273

48

Tollefsen

KE

2002

Взаимодействие миметиков эстрогена, по отдельности и в комбинации, с белками половых стероидов плазмы крови ( Oncorhynchus mykiss ).

Aquat Toxicol

56

:

215

225

49

Foucher

JL

,

Niu

PD

,

Mourot

B

ant

F

1991

Исследования in vivo и in vitro регуляции половых стероидсвязывающих белков (SBP) у радужной форели (Oncorhynchus mykiss): влияние половых стероидных гормонов и факторов, связанных с ростом и метаболизмом.

J Стероид Biochem Mol Biol

39

:

975

986

50

Foucher

JL

,

Le Bail

PY

,

1992 Le Gac

Fluence

Забор гипофизэктомия, кастрация, голодание и спермиация на концентрацию САД у самцов радужной форели ( Oncorhynchus mykiss ).

Gen Comp Endocrinol

85

:

101

110

51

Foucher

JL

,

Le Gac

F

1989

Доказательства наличия андрогенного связывания белка рыба ( Salmo gairdneri R .): потенциальный маркер функции клеток Сертоли.

J Стероид Biochem

32

:

545

552

52

Caldwell

JD

,

Suleman

F

,

Chou

SH

pi, RA

SH

pi, RA

SH

pi

Z

,

Jirikowski

GF

2006

Новые роли стероидсвязывающих глобулинов.

Horm Metab Res

38

:

206

218

53

Hammond

GL

1995

Возможные функции белков, связывающих стероиды плазмы.

Trends Endocrinol Metab

6

:

298

304

54

Joseph

DR

1994

Структура, функция и регуляция андроген-связывающего белка / полового гормона глобулина.

Vitam Horm

49

:

197

280

55

Крупенко

SA

,

Крупенко

NI

,

Danzo связывание

BJ

gloin с плазматическими мембранами придатка яичка крысы и других тканей.

J Стероид Biochem Mol Biol

51

:

115

124

56

Rosner

W

,

Hryb

DJ

,

Хан

MS

000

000 MS

la

la

la

Romas

NA

1999

Глобулин, связывающий половые гормоны, опосредует передачу сигнала стероидного гормона через плазматическую мембрану.

J Стероид Biochem Mol Biol

69

:

481

485

57

Lee

WM

,

Wong

AS

,

Tu

AW

,

Li

JC

,

Hammond

GL

1997

Глобулин, связывающий половые гормоны кролика: первичная структура, экспрессия в тканях и анализ структуры / функции по экспрессии в Escherichia coli .

J Эндокринол

153

:

373

384

58

Noe

G

1999

Экспрессия глобулина, связывающего половые гормоны, и совместная локализация с рецептором эстрогена в фаллопиевой трубе человека.

J Стероид Biochem Mol Biol

68

:

111

117

59

Wong

AS

,

Lui

WY

,

Hui

IT Lee

,

2001

Глобулин, связывающий половые гормоны кролика: экспрессия в печени и семенниках во время постнатального развития и структурная характеристика усеченными белками.

Int J Androl

24

:

165

174

60

Andersen

CY

1990

Уровни стероидсвязывающих белков и стероидов в преовуляторных фолликулах жидкости и сыворотке крови человека в предовуляторных фолликулах in vitro оплодотворение-перенос эмбриона.

J Clin Endocrinol Metab

71

:

1375

1381

61

Бен Рафаэль

Z

,

Мастроянни младший

L

,

000

000

0002 Meloni Lee

Flickinger

GL

1986

Общий эстрадиол, свободный эстрадиол, глобулин, связывающий половые гормоны, и фракция эстрадиола, связанного с глобулином, связывающим половые гормоны, в фолликулярной жидкости человека.

J Clin Endocrinol Metab

63

:

1106

1111

62

Campo

SM

,

Carson

RS

,

Findlay

специфического JK

9000 участки в фолликуле яичника овцы.

Mol Cell Endocrinol

39

:

255

265

63

Martin

B

,

Rotten

D

,

Jolivet

A

JP

Gautray

Связывание стероидов белками фолликулярной жидкости яичника человека.

J Clin Endocrinol Metab

53

:

443

447

64

Scott

AP

,

Sumpter

JP

,

Hardiman

PA

Изменение радужная форель ( Salmo gairdneri, Richardson).

Gen Comp Endocrinol

49

:

128

134

65

Jalabert

B

,

Fostier

A

,

Breton

B

1991 Созревание ооцитов у позвоночных.В:

Pang

P

,

Schreibman

M

, ред. Эндокринология позвоночных, основы и биомедицинские аспекты.

Том 4. Нью-Йорк

:

Academic Press

;

23

90

66

Macklon

NS

,

Fauser

BC

1998

Развитие фолликулов во время нормального менструального цикла.

Maturitas

30

:

181

188

67

Fostier

A

,

Jalabert

B

1986

Стероидулогенез на разных стадиях ветряной эрозии изменения уровня гормонов в плазме и реакции яичников на гонадотропин лосося in vivo и in vitro.

Fish Physiol Biochem

2

:

87

99

Авторские права © 2008 Общества эндокринологов

Расположение: Сепидиус — Wizard101 Wiki

Описание

Эмпирея Сепидиус

Щелкните здесь, чтобы узнать цены на Эмпирею и ее местоположения.

Сепидиус, также известный как «Желудок», — самый большой небесный кальмар в Эмпиреи.Волшебники сначала путешествуют сюда во время квеста Eat or Be Eaten , чтобы остановить Медуллу и его темный заговор.

Карта

Реагенты собраны здесь

Нормальный урожай

Здесь не указаны реагенты для нормального урожая

Rare Harvest

Здесь не сообщается о реагентах Rare Harvest

Запертые сундуки

Здесь нет запертых сундуков

Здесь пойманная рыба

Рыбы здесь нет

Рыбный сундук, найденные здесь

Шляпы
Здесь нет головных уборов
Одеяния
Здесь не сообщается об одежде
Ботинки
Сапоги здесь не указаны
Жезлы
Здесь нет сообщений о Жезлах
Athames
Здесь нет сообщений об Athames
Амулеты
Об амулетах здесь не сообщается
Кольца
Здесь нет информации о кольцах
Колоды
Здесь нет описаний колод
Объекты жилья
Здесь нет данных о жилищных объектах
Семена
Здесь не сообщается о семенах
Реагенты
Здесь нет данных о реагентах
Закуски для домашних животных
Здесь не сообщается о закусках для домашних животных
Домашние животные
Нет сообщений о домашних животных здесь
Крепления
Никаких креплений здесь не сообщается
Драгоценностей
Здесь не сообщается о драгоценных камнях

Подсказки, руководства и обсуждения содержания Wiki, относящегося к Sepidious, следует поместить в тему обсуждения.

Если тема еще не создана (т. Е. Ссылка приводит вас к пустому поиску), вы должны создать тему, используя описанное здесь соглашение об именах тем.

Документацию по редактированию этой страницы см. В Template: LocationInfobox / doc.

Витафел глобулин — ветсправка

Глобулин VITAFEL

Név VITAFEL globulin-összetétel представляет собой форму Globulin Vitafel tartalmaz nagytisztaságú gamma és béta-globulin frakció a szérum donor macskák, macska panleukopenia hiperimkószkazka.A megjelenése egy színtelen vagy halványsárga áttetsző, enyhén opálos folyadék. A tárolás során аз iszap kialakulását, ami könnyen törik rázással egységes iszapot. Fiolákba töltjük, 1 мл (1 адаг). Farmakológiai tulajdonságok passzív immunitás kezelt állatok profilaktikus Vitafel globulint tartjuk legalább két hétig. Indikációk hozzárendelése macskák és más macskafélék specificikus megelőzésére — kezelésére macska panleukopenia, fertőz rhinotracheitis, macska calicivirrus és chlamydia. Adagolás és felhasználási та а fertőzés megelőzésére панлейкопения, ринотрахеит fertőző, A macska Calicivirus és ного vakcinázott хламидия házimacska és más macskafélék глобулин Vitafel használni: аз eredménytelen következő betegségek megelőzésére faiskolák betegség klinikailag egészséges állatok; felkeresése előtt kiállítások és egyéb nyilvános rendezvények kapcsolatos esetleges érintkezés egészséges állatok beteg; эладас элетт ваги атадаса чика ваги фельнетт аллаток мас кертесзетек хоги мегакадальоззак аз эсетлегес сзеннезедес; mielőtt a viszkózus állatok; ellési macskák tenyésztők diszfunkcionális, hogy a tartós kolosztrum (tejből készültek) mentesség a macskák; Újszülött kiscicák nyert nem vakcinázott, és a gyanús a betegség macskákban hátrányos faiskolákban.Vírusfertőzések megelőzésére Vitafel globulint szubkután adtuk be az állatoknak dózisban 1 мл (1 adag) egyszer vagy kétszer időközzel 24 óra. Lejártával a kialakulását passzív Immunitás létrehozására irányuló aktívmunitás vakcinakészítmény. A gyógyszeres kezelés alkalmazható gyanúsított megfertőzni ezeket a fertőzéseket. Legnagyobb terápiás hatás érhető el, ha a hatóanyag a kezdeti szakaszban a betegség. Витафел глобулин быть аз állatoknak szubkután и jelzett dózisokban háromszor időközönként 12 — 24 óra súlyosságától függően az állat állapotától függően.Globulin lehet alkalmazni a háttérben tüneti kezelésére, beadása витаминок, антибиотикумок и пробиотикумок. Amikor kötőhártyagyulladás, amelyet herpeszvírusok, calicivírus — это Chlamydia Vitafel globulin használt szemcsepp formájában: temetve termék 2 — 3-szor egy nap, 1 — 3 csepp mindkét szembét szembét szembét szembét szembét szembét szembét szembét szembét szembét szembét szembét szembéts. A nátha gyógyszer cseppentve az orrba. Vitafel globulin lehet hozzárendelni az állat, függetlenül a kor és a fizikai állapot (terhesség, szoptatás, stb). Ha globulin Vitafel kell betartani a szabályokat aszepszis és antiszepszis.Mellékhatások Enyhe fájdalom az injekció pont globulin. Ritka esetekben allergiás reakciók léphetnek fel. Амикор и витамин Витафел, применяемый в качестве лекарственного средства, лекарственного средства, лекарственного средства, лекарственного средства, анафилаксии, антигистаминного средства (дифенгидрамин, супрастинум, тавегилум), витаминный препарат, содержащий 30 мл жидкости, лекарственный препарат, применяемый в качестве лекарственного средства. Szembeni súlyosallergiás reakciók аз előző adminisztráció. Különleges utasítások Különleges óvintézkedések nem biztosított. Az érintkezés után globulin Vitafel a bőrrel vagy nyálkahártyával ajánlott mosni őket vízzel.Jelenléte gyógyszer-szennyezések, ная szétváló pelyhek, penészgombák, megsérti integritását ampullák, Nincs címke, valamint аз időszak lejárta érvényességi vagy нэм használja megnyitó napján аз ампула felkészülés rendelkezésére Все, Amely ной igényel Specialis biztonsági intézkedéseket. Tárolási feelételek Száraz helyen, fénytől védve, elzárva a gyermekek és állatok helyen hőmérsékleten 2 és 18 ° C-on Élettartam — 2 év. Gyártó Vonal Alba PBCN Company, Magyarország

Kapcsolódó hírek:

Kapcsolódó cikkek

круизов по Египту и Нилу (только онлайн) — Глава 10-2020 Желтая книга | Здоровье путешественников

ВОПРОСЫ ЗДОРОВЬЯ

В дополнение к актуальным сведениям о стандартных вакцинах, путешественникам в Египет рекомендуются вакцины против гепатита А и В и брюшного тифа.Инфекция вирусом гепатита С и инфекция вирусом гепатита В являются серьезными проблемами общественного здравоохранения. Путешественников следует предостеречь, чтобы они защищали себя от всех патогенов, передающихся с кровью, избегая незащищенного секса, инвазивных медицинских и стоматологических процедур, инъекций наркотиков и нанесения татуировок. Современные больницы и клиники обслуживают экспатриантов в Каире и Александрии, а также туристов в курортных районах Красного моря.

Диарея путешественников

В большинстве крупных международных туристических отелей водопроводная вода достаточно хлорирована, но вода в бутылках обычно предназначена для питья.В других местах пить водопроводную воду небезопасно. Тщательно приготовленное мясо и овощи в туристических отелях, на круизных лайнерах по реке Нил и в туристических ресторанах, как правило, безопасно. Следует избегать употребления сырого или недоваренного фарша или моллюсков. Как и во многих развивающихся странах, безопасность сырых овощей и салатов вызывает сомнения. Риск диареи в Египте высок. Клиницисты должны рассмотреть возможность назначения антибиотиков путешественникам в Египет для эмпирического самолечения диареи.

Шистосомоз

Schistosoma mansoni и S. haematobium являются эндемиками Египта. Путешественникам в Египет следует избегать перехода вброд, плавания или других контактов с пресной водой, включая реку Нил и оросительные каналы. Купание в соленых бассейнах пустынных оазисов, хлорированных бассейнах, Средиземном или Красном море не представляет риска для заражения шистосомозом.

Бешенство

Как и в большинстве других развивающихся стран, бешенство является эндемическим заболеванием по всему Египту.Для большинства путешественников пакетного тура риск будет минимальным. Тем не менее, путешественники должны знать, что в городских и туристических районах обитает большое количество бездомных собак и кошек, и им следует рекомендовать избегать контактов с домашними или дикими млекопитающими. Вакцина против бешенства доступна для профилактики до и после контакта; Человеческий антирабический иммуноглобулин (HRIG) также доступен (см. главу 4, Бешенство). Вакцина против бешенства и HRIG импортируются.

Проблемы окружающей среды

Температура и погодные условия в Египте сильно различаются.Летом в пустыне очень жарко (> 100 ° F;> 38 ° C), а зимой может быть холодно (<32 ° F; <0 ° C). Жажда является поздним признаком обезвоживания, и путешественникам следует регулярно пить жидкость в жару. Поскольку пот сразу испаряется, люди могут обезвоживаться, даже не осознавая этого. Пожилые путешественники, принимающие мочегонные, холинолитики или нейролептики, подвержены повышенному риску заболеваний, связанных с жарой. Чтобы сохранять прохладу и защищаться от воздействия солнца, путешественники должны носить шляпу и легкую свободную одежду, а также пользоваться солнцезащитным кремом.

Песчаные бури случаются в пустыне время от времени. Песок, пыль и смог пустыни могут вызвать раздражение глаз и обострить астму или другие заболевания легких. Путешественникам, которые носят контактные линзы, следует взять с собой очки и средства по уходу за контактными линзами.

Движение

В целом Нил — медленная, плавная река. Однако сочетание дизельного топлива, тепла и движения может причинить беспокойство путешественникам. Большинство путешественников не рассматривают возможность укачивания на реке, поэтому не готовы.Бортовые медицинские услуги сильно различаются. Путешественникам, которые знают, что они чувствительны к движению, следует иметь при себе лекарства от укачивания.

Насекомые

Комары и другие кусающие насекомые могут стать проблемой для путешественников. Избегание укусов насекомых предотвратит местный дискомфорт и раздражение и снизит риск трансмиссивных заболеваний. Денге редко встречается у путешественников, посетивших Египет. Хотя показатели серологической распространенности вируса Западного Нила высоки (24%) и передача широко распространена, инфекции у возвращающихся путешественников, по-видимому, встречаются редко.

Последний раз об изолированной местной передаче малярии сообщалось в губернаторстве Асуан в 2014 году. Хотя профилактика малярии не рекомендуется, путешественникам следует соблюдать меры предосторожности в отношении насекомых (см. Главу 3, Комары, клещи и другие членистоногие). У путешественников с лихорадкой, возвращающихся из Египта, следует рассмотреть вопрос о трансмиссионных заболеваниях.

БИБЛИОГРАФИЯ

  1. Burdino E, Milia MG, Sergi G, Gregori G, Allice T, Cazzato ML и др. Диагностика лихорадки денге в Северо-Западной Италии у путешественников из эндемичных регионов: ретроспективное исследование.J Clin Virol. 2011 август; 51 (4): 259–63.
  2. Gautret P, Schlagenhauf P, Gaudart J, Castelli F, Brouqui P, von Sonnenburg F, et al. Многоцентровое исследование EuroTravNet / GeoSentinel по инфекционным заболеваниям, связанным с путешествиями, в Европе. Emerg Infect Dis. 2009 ноябрь; 15 (11): 1783–90.
  3. Кандил А., Хаггаг А.А., Або Эль Фетух М., Наил М., Рефей С.А., Хассан А.Х., Рамзи Р.М.Р. Борьба со вспышкой малярии, вызванной Plasmodium vivax , в мухафазе Асуан, Египет. EMHJ. 2016; 22 (4): 274–9.
  4. Министерство здравоохранения и народонаселения [Египет], Эль-Занати и партнеры [Египет] и ICF International. Обзор вопросов здравоохранения в Египте, 2015 г. Каир, Египет и Роквилл, Мэриленд, США: Министерство здравоохранения и народонаселения и ICF International, 2015 г. [цитировано 27 апреля 2017 г.]. Доступно по адресу http://dhsprogram.com/pubs/pdf/FR313/FR313.pdf
  5. Солиман А., Мохареб Э., Салман Д., Саад М., Салама С., Файез С. и др. Исследования вирусной инфекции Западного Нила в Египте. J заразить общественное здравоохранение.2010. 3 (2): 54–9.

Новый, функциональный и сильно дивергентный глобулин, связывающий половые гормоны, который может участвовать в местном контроле функций яичников у лососевых

Когда-либо, примечательно, что это повышение регуляции было обнаружено

весьма вариабельно среди самок и не всегда существенный.

В совокупности эти наблюдения согласуются с гипотезой

esis о ко-регуляции shbgb и cyp19a в яичнике радужной форели

. Кроме того, как SHBGb, так и cyp19a синтезируются

в клетках гранулезы позднего вителлогенного фолликула.Таким образом,

,

shbgb и cyp19a пространственно и временно коэкспрессируются

во время позднего вителлогенеза, пост-вителлогенеза и созревания ооцитов

. Экспрессия shbgb высока во время позднего генеза vitello-

, до созревания ооцитов, в то время, когда активность ароматазы

и уровни эстрадиола (64) также высоки. Такая высокая экспрессия

в клетках гранулез пост-вителлогенных фолликулов яичников

у видов, не обладающих антральным отделом (65), составляет

, что соответствует обнаружению SHBG в фолликулярной жидкости

развивающихся доминантных фолликулов млекопитающих на время, когда

активность ароматазы и уровни эстрадиола также высоки (66).Снижение на

экспрессии генов shbgb и cyp19a радужной форели

происходит в то время, когда уровни циркулирующего E2 и активность ароматазы

резко падают, в то время как уровни андростендиона и

тестостерона повышаются (64, 67). Вместе эти наблюдения

вариаций вместе с преобладающей в яичниках экспрессией

SHBGb предполагают, что SHBGb участвует в действии

эстрогенов и / или андрогенов в яичниках. На основании существующей литературы по млекопитающим, SHBGb может либо действовать, регулируя биодоступность генов эстро-

и / или андрогенов в фолликуле яичников

, либо активно участвовать в действии эстрогенов и / или ан-

дрогенов на фолликулы. клетки.

Благодарности

Получено 30 ноября 2007 г. Принято 5 марта 2008 г.

Направляйте всю корреспонденцию и запросы на перепечатку по адресу: Julien Bobe,

Institut National de la Recherche Agronomique, Unite´ de Recherche

1037 SCRIBE, Institit Fe´de´ratif de Recherche 140, Ouest-Genopole,

35000 Ренн, Франция. Эл. Почта: [email protected]

Эти данные о последовательностях были отправлены в базу данных GenBank

под номером доступа.EF577269.

Текущий адрес D.V .: Facultad de Ciencias, Oceanologı´a, Igua´

4225, Montevideo 11400, Uruguay.

Заявление о раскрытии информации: авторам нечего раскрывать.

Ссылки

1. Селби C 1990 Глобулин, связывающий половые гормоны: происхождение, функция и клиническое значение

. Ann Clin Biochem 27 (Pt 6): 532–541

2. Siiteri PK, Murai JT, Hammond GL, Nisker JA, Raymoure WJ, Kuhn RW

1982 Сывороточный транспорт стероидных гормонов.Недавний Prog Horm Res 38:

457–510

3. Мендель CM 1989 Гипотеза свободных гормонов: физиологически обоснованная математическая модель. Endocr Rev 10: 232–274

4. Кан С. М., Хриб Д. Д., Накла А. М., Ромас Н. А., Рознер В. 2002 Половой гормон-

В клетках-мишенях синтезируется связывающий глобулин

. J Endocrinol 175: 113–120

5. Hryb DJ, Nakhla AM, Kahn SM, St George J, Levy NC, Romas NA, Rosner

W 2002 Глобулин, связывающий половые гормоны в простате человека, локально син-

соответствующего размера и может действовать как аутокринный / паракринный эффектор.J Biol Chem 277:

26618–26622

6. Selva DM, Hammond GL 2006 Глобулин, связывающий половые гормоны человека,

экспрессируется в половых клетках семенников, а не в клетках Сертоли. Horm Metab Res

38: 230–235

7. Rosner W, Khan MS, Breed CN, Fleisher M, Bradlow HL 1985 Плазменный стероид-

связывающих белков в кистах кистозной болезни груди. J Clin

Endocrinol Metab 61: 200–203

8. Форджес Т., Жерар А., Хесс К., Монье-Барбарино П., Жерар Н. 2004 Экспрессия

глобулина, связывающего половые гормоны (ГСПГ), в гранулезно-лютеиновых клетках человека .Mol

Cell Endocrinol 219: 61–68

9. Forges T, Gerard A, Monnier-Barbarino P, Gerard H 2005 Иммунолокализация —

глобулина, связывающего половые гормоны (SHBG) в фолликулах яичников человека и

корпусе лютеум. Histochem Cell Biol 124: 285–290

10. Salhanick AC, Callard IP 1980 Белок, связывающий половые стероиды в плазме

пресноводной черепахи Chrysemys picta. Gen Comp Endocrinol 42: 163–166

11. Paolucci M, Di Fiore MM 1994 Белки, связывающие половые стероиды в плазме

зеленой лягушки, Rana esculenta: изменения во время репродуктивного цикла и зависимость

от гипофиза и гонад .Gen Comp Endocrinol 96: 401– 411

12. Hobby AC, Geraghty DP, Pankhurst NW 2000 Различия в характере связывания —

характеристики связывающего половые стероиды белка в репродуктивных и непродуктивных

самках радужной форели (Oncorhynchus mykiss), черного леща (Acanthopagrus butch-

eri) и камбала зеленая (Rhombosolea tapirina). Gen Comp Endocrinol

120: 249–259

13. Miguel-Queralt S, Knowlton M, Avvakumov GV, Al Nouno R, Kelly GM,

Hammond GL 2004 Молекулярная и функциональная характеристика полового гормона

связывающий глобулин у рыбок данио .Endocrinology 145: 5221–5230

14. Miguel-Queralt S, Avvakumov GV, Blazquez M, Piferrer F, Hammond GL

2005 Глобулин, связывающий половые гормоны морского окуня (Dicentrarchus labrax): молекулярный

, биохимические свойства и филогенетические свойства. его ортологи у

множественных видов рыб. Mol Cell Endocrinol 229: 21–29

15. Miguel-Queralt S, Blazquez M, Piferrer F, Hammond GL 2007 Половой гормон —

Экспрессия

связывающего глобулина у морского окуня (Dicentrarchus labrax L.) на протяжении

развития и репродуктивного сезона. Mol Cell Endocrinol 276: 55–62

16. Thorgaard GH, Bailey GS, Williams D, Buhler DR, Kaattari SL, Ristow SS,

Hansen JD, Winton JR, Bartholomew JL, Nagler JJ, Walsh PJ, Vijayan MM,

Devlin RH, Hardy RW, Overturf KE, Young WP, Robison BD, Rexroad C,

Palti Y 2002 Статус и возможности исследования геномики радужной форели

. Comp Biochem Physiol B Biochem Mol Biol 133: 609 — 646

17.Meyer A, Van de PY 2005 От 2R до 3R: доказательства дупликации генома, специфичного для рыб

(FSGD). Bioessays 27: 937–945

18. Аллендорф Ф. В., Торгаард Г. Х. 1984 Тетраплоидия и эволюция лососевых

рыб. В: Тернер Б.Дж., изд. Эволюционная генетика рыб. Нью-Йорк: Пленум

Пресс; 1–53

19. Rexroad CE, Lee Y, Keele JW, Karamycheva S, Brown G, Koop B, Gahr SA,

Palti Y, Quackenbush J 2003 Анализ последовательности кДНК радужной форели

библиотеки и создание библиотеки генный индекс.Cytogenet Genome Res 102: 347–354

20. Govoroun M, Le Gac F, Guiguen Y 2006 Создание широкомасштабного репертуара

тегов экспрессируемых последовательностей (EST) из нормализованных библиотек кДНК радужной форели

. BMC Genomics 7: 196

21. Bobe J, Montfort J, Nguyen T., Fostier A 2006 Идентификация новых участников

в процессах созревания и овуляции ооцитов радужной форели (Oncorhynchus mykiss)

с использованием микрочипов кДНК. Репрод Биол Эндокринол 4:39

22.Kamangar BB, Gabillard JC, Bobe J 2006 Связывание с инсулиноподобным фактором роста

белок (IGFBP) -1, -2, -3, -4, -5 и -6 и связанный с IGFBP белок 1 во время

радуги Поствителлогенез форели и созревание ооцитов: молекулярная характеристика, профили экспрессии и гормональная регуляция. Эндокринология 147:

2399–2410

23. Billard R 1992 Размножение радужной форели: половая дифференциация, динамика

гаметогенеза, биологии и сохранения гамет.Аквакультура 100: 263–

298

24. Гуре П., Витиелло В., Баландро Н., Жиль А., Понтаротти П., Данчин Э. Г. 2005

FIGENIX: интеллектуальная автоматизация геномной аннотации: интеграция опыта

в новую программную платформу. BMC Bioinformatics 6: 198

25. Сайтоу Н., Ней М. 1987 Метод объединения соседей: новый метод для повторного построения филогенетических деревьев. Mol Biol Evol 4: 406 — 425

26. Felsenstein J 1981 Эволюционные деревья из последовательностей ДНК: подход с максимальным вероятностью

.J Mol Evol 17: 368 –376

27. Nei M 1996 Филогенетический анализ в молекулярной эволюционной генетике. Annu

Rev Genet 30: 371–403

28. Bobe J, Nguyen T, Jalabert B 2004 Целевое профилирование экспрессии генов в яичнике радужной форели

(Oncorhynchus mykiss) во время созревания

приобретение

и созревание ооцитов. Biol Reprod 71: 73–82

29. Mourot B, Nguyen T, Fostier A, Bobe J 2006 Два несвязанных предполагаемых мем-

связанных с браной рецепторов прогестина, компонент рецептора мембраны прогестерона

нент 1 (PGMRC1) и мембрана рецептор прогестина (mPR)

, экспрессируются

в ооцитах радужной форели и демонстрируют сходные паттерны экспрессии в яичниках.

Reprod Biol Endocrinol 4: 6

ТАБЛИЦА 1. Относительная аффинность связывания различных стероидов для

радужной форели SHBGb

Относительная аффинность связывания стероидов

T 100

E2 100

2-метоксиэстрадиотест

2-метоксиэстрадиотест

9

5

-Дигидротестостерон 2

17-гидроксипрогестерон 0,1

F 0,1

Значения относительной аффинности связывания выражены как отношение концентрации радиоинертного T

к концентрациям специфических стероидов 3

, что дает

снижение на 50% специфического связывания 关

3

H T с радужной форелью

SHBGb, продуцируемым в клетках COS-7.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *