Действие яда черной мамбы: Биологи превратили яд черной мамбы в мощный анальгетик

Автор: | 13.03.2020

Содержание

Каково это – пережить 200 укусов и 700 инъекций смертельного змеиного яда Статьи редакции

Почти 20 лет американец экспериментировал с собственным телом, чтобы получить идеальное противоядие. Это далось дорогой ценой.

{«id»:98185,»url»:»https:\/\/tjournal.ru\/stories\/98185-kakovo-eto-perezhit-200-ukusov-i-700-inekciy-smertelnogo-zmeinogo-yada»,»title»:»\u041a\u0430\u043a\u043e\u0432\u043e \u044d\u0442\u043e \u2013 \u043f\u0435\u0440\u0435\u0436\u0438\u0442\u044c 200 \u0443\u043a\u0443\u0441\u043e\u0432 \u0438 700 \u0438\u043d\u044a\u0435\u043a\u0446\u0438\u0439 \u0441\u043c\u0435\u0440\u0442\u0435\u043b\u044c\u043d\u043e\u0433\u043e \u0437\u043c\u0435\u0438\u043d\u043e\u0433\u043e \u044f\u0434\u0430″,»services»:{«vkontakte»:{«url»:»https:\/\/vk.

com\/share.php?url=https:\/\/tjournal.ru\/stories\/98185-kakovo-eto-perezhit-200-ukusov-i-700-inekciy-smertelnogo-zmeinogo-yada&title=\u041a\u0430\u043a\u043e\u0432\u043e \u044d\u0442\u043e \u2013 \u043f\u0435\u0440\u0435\u0436\u0438\u0442\u044c 200 \u0443\u043a\u0443\u0441\u043e\u0432 \u0438 700 \u0438\u043d\u044a\u0435\u043a\u0446\u0438\u0439 \u0441\u043c\u0435\u0440\u0442\u0435\u043b\u044c\u043d\u043e\u0433\u043e \u0437\u043c\u0435\u0438\u043d\u043e\u0433\u043e \u044f\u0434\u0430″,»short_name»:»VK»,»title»:»\u0412\u041a\u043e\u043d\u0442\u0430\u043a\u0442\u0435″,»width»:600,»height»:450},»facebook»:{«url»:»https:\/\/www.facebook.com\/sharer\/sharer.php?u=https:\/\/tjournal.ru\/stories\/98185-kakovo-eto-perezhit-200-ukusov-i-700-inekciy-smertelnogo-zmeinogo-yada»,»short_name»:»FB»,»title»:»Facebook»,»width»:600,»height»:450},»twitter»:{«url»:»https:\/\/twitter.com\/intent\/tweet?url=https:\/\/tjournal.ru\/stories\/98185-kakovo-eto-perezhit-200-ukusov-i-700-inekciy-smertelnogo-zmeinogo-yada&text=\u041a\u0430\u043a\u043e\u0432\u043e \u044d\u0442\u043e \u2013 \u043f\u0435\u0440\u0435\u0436\u0438\u0442\u044c 200 \u0443\u043a\u0443\u0441\u043e\u0432 \u0438 700 \u0438\u043d\u044a\u0435\u043a\u0446\u0438\u0439 \u0441\u043c\u0435\u0440\u0442\u0435\u043b\u044c\u043d\u043e\u0433\u043e \u0437\u043c\u0435\u0438\u043d\u043e\u0433\u043e \u044f\u0434\u0430″,»short_name»:»TW»,»title»:»Twitter»,»width»:600,»height»:450},»telegram»:{«url»:»tg:\/\/msg_url?url=https:\/\/tjournal.
ru\/stories\/98185-kakovo-eto-perezhit-200-ukusov-i-700-inekciy-smertelnogo-zmeinogo-yada&text=\u041a\u0430\u043a\u043e\u0432\u043e \u044d\u0442\u043e \u2013 \u043f\u0435\u0440\u0435\u0436\u0438\u0442\u044c 200 \u0443\u043a\u0443\u0441\u043e\u0432 \u0438 700 \u0438\u043d\u044a\u0435\u043a\u0446\u0438\u0439 \u0441\u043c\u0435\u0440\u0442\u0435\u043b\u044c\u043d\u043e\u0433\u043e \u0437\u043c\u0435\u0438\u043d\u043e\u0433\u043e \u044f\u0434\u0430″,»short_name»:»TG»,»title»:»Telegram»,»width»:600,»height»:450},»odnoklassniki»:{«url»:»http:\/\/connect.ok.ru\/dk?st.cmd=WidgetSharePreview&service=odnoklassniki&st.shareUrl=https:\/\/tjournal.ru\/stories\/98185-kakovo-eto-perezhit-200-ukusov-i-700-inekciy-smertelnogo-zmeinogo-yada»,»short_name»:»OK»,»title»:»\u041e\u0434\u043d\u043e\u043a\u043b\u0430\u0441\u0441\u043d\u0438\u043a\u0438″,»width»:600,»height»:450},»email»:{«url»:»mailto:?subject=\u041a\u0430\u043a\u043e\u0432\u043e \u044d\u0442\u043e \u2013 \u043f\u0435\u0440\u0435\u0436\u0438\u0442\u044c 200 \u0443\u043a\u0443\u0441\u043e\u0432 \u0438 700 \u0438\u043d\u044a\u0435\u043a\u0446\u0438\u0439 \u0441\u043c\u0435\u0440\u0442\u0435\u043b\u044c\u043d\u043e\u0433\u043e \u0437\u043c\u0435\u0438\u043d\u043e\u0433\u043e \u044f\u0434\u0430&body=https:\/\/tjournal.
ru\/stories\/98185-kakovo-eto-perezhit-200-ukusov-i-700-inekciy-smertelnogo-zmeinogo-yada»,»short_name»:»Email»,»title»:»\u041e\u0442\u043f\u0440\u0430\u0432\u0438\u0442\u044c \u043d\u0430 \u043f\u043e\u0447\u0442\u0443″,»width»:600,»height»:450}},»isFavorited»:false}

47 804 просмотров

Тим Фриде Фото HotSpot Media

В 2016 году Тим Фриде (Tim Friede) как обычно взял крюк и подцепил из специального ящика тайпана – одну из самых ядовитых змей мира. Он прижал голову особи к своему запястью, и несколько секунд спустя змея два раза вонзила клыки в руку мужчины. В это время из глубоких дыр на другой руке, которые оставила чёрная мамба, уже сочилась кровь.

Атака любой из этих змей может остановить биение сердца человека за несколько часов, а симптомы вроде опущенных век и паралича языка развиваются за несколько секунд. Но Фриде чувствовал себя нормально – убрав змей, он повернулся к камере, которая записывала процесс для его YouTube-канала, и сказал: «Обожаю. Обожаю. Обожаю».

Для стороннего зрителя мужчина кажется безумцем, но на деле его действия давно просчитаны. Годами он приучал свой организм противостоять ядам самых опасных змей, добившись в этом таких успехов, что воспринимается учёными как живой человеческий эксперимент. Историю Фриде рассказал журнал Outside.

Проверка на смертность

У Фриде, которому в 2019 году исполнился 51 год, есть правило – если после первых 15 минут после укуса чёрной мамбы он не умрёт, дальше можно не переживать. Как-то раз после атаки змеи он вышел на кухню к своей девушке Гретхен Грили (Gretchen Greeley) и буднично попросил дать ему 15 минут на восстановление. И потерял сознание. Крапивницы, с которой он сталкивался регулярно после попадания яда, в этот раз не было, он даже мог дышать. Через пять минут такого состояния он встал и дошёл до ванной, где вновь потерял сознание. «Я ударился головой о раковину. Но выжил. Это было месяца два назад», – обыденно рассказывал Фриде.

Сын школьных преподавателей, он никогда не видел родителей, которые отдали его в приют. В три года его усыновили полицейский и его жена-домохозяйка, он поселился с ними в Милуоки (штат Висконсин). С детства Фриде гонялся за змеями и мечтал попасть в спецназ, но после нескольких травм оставил надежды на службу и устроился мойщиком окон. Лишь в районе 30 лет, в поисках способа изменить жизнь, он записался на курсы по извлечению ядов из пауков и скорпионов.

А спустя какое-то время весь его интерес сосредоточился на змеях и поиске иммунитета от их ядов.

Свой первый «контролируемый» укус Фриде провёл через несколько дней после гибели своей подруги и на следующий день после национальной трагедии – 11 сентября 2001 года. Находясь на грани депрессии, он напился и попытался выдавить яд из египетской кобры, но в ответ она укусила его в средний палец. До этого он в течение года приучал свой организм бороться с токсинами, делая себе уколы яда. Благодаря этому он не только выжил, но и почти не почувствовал яд. Радостный, он вошёл в гостиную и поделился впечатлениями с женой и шестилетним сыном. «Это всё изменило. В тот день я впервые победил смерть», – вспоминает мужчина.

Фриде демонстрирует способность пережить укус чёрной мамбы.

Осторожно, запись может шокировать

Через час Фриде захотел попробовать ещё раз. Он вернулся в подвал, который оборудовал под своеобразную лабораторию, и достал из ящика голыми руками моноклевую кобру. Недолго думая, змея впилась незнакомцу в правый бицепс. Яд стремительно разошёлся по телу, вскоре Фриде полностью парализовало. «Мне было до смерти страшно», – вспоминает мужчина. Потеряв способность двигаться, он слышал, как к нему прибыли медики и обсуждали, жив ли он.

Для победы над токсинами потребовалось шесть флаконов противоядия, но следующие четыре дня мужчина всё равно провёл в коме. «Об этом очень трудно говорить, это просто ****** (чертова) катастрофа. Хотел бы я, чтобы этого никогда не произошло», – говорит Фриде. Однако именно этот случай подстегнул его к новому вызову – он решил закалить свой организм так, чтобы за одну ночь выдержать укусы двух ядовитых змей без противоядия.

Для этого американцу нужно было научить тело вырабатывать достаточно антител для борьбы с токсинами. Обычные люди не обладают этим свойством, так как змеиный яд попадает в их организм редко (а порой никогда), тело не имеет иммунитета от подобных атак. Исправить это можно лишь регулярными инъекциями токсинов – чем их больше, тем эффективнее становятся антитела.

Этим Фриде и занялся, заказав домой множество самых опасных змей (в оригинальном материале не уточняется, были ли у американца проблемы с владением столь опасными существами).

Фото Outside

В 2017 году на американца вышел молодой иммунолог Джейкоб Гланвилл (Jacob Glanville), который искал способ сделать себе имя и увидел во Фриде пример невероятной иммунной системы, которая позволяет выдерживать самые тяжёлые токсины. Гланвилл задумался, сможет ли он извлечь антитела мужчины для создания универсального противоядия. Вскоре партнёры заключили сделку – Фриде предоставляет учёному свои антитела, а тот на их основе синтезирует противоядие и выводит препарат на рынок. Доход делится пополам – в перспективе это миллионы долларов.

Фриде всегда относился к идее с большим энтузиазмом. Он рассказывал о ней в барах, поясняя, как его антитела могут стать основой для синтезирования универсального противоядия. Слушатели, как и сам мужчина, знали немногое о сложностях создания подобного антидота, но такая концепция не могла не увлекать. Как-то раз в кафе местный менеджер проникся историей и подарил Фриде бутылку пива и стопку виски за счёт заведения. «Ты герой», – сказал мужчина. Но Фриде повёл себя скромно: «Нет, нет, нет. Это не так. Я просто идиот, которого кусают змеи».

Надежды на прорыв

Примерно через год после начала экспериментов Фриде без страха демонстрировал способности своего иммунитета, спокойно переживая укусы. Иногда он мог определить количество впрыснутого яда лишь по реакции организма. У мужчины завелись любимцы – ему нравились водяные кобры, потому что их нейротоксичный яд блокировал нервные клетки, в следствии чего укус становился менее болезненным. В свою очередь он терпеть не мог капскую кобру и гремучую змею, потому что их некротический яд растворял мышцы.

Почувствовав себя уверенно, мужчина завёл YouTube-канал, куда выкладывал записи контролируемых укусов и с научной точки зрения объяснял, как змеиный яд влияет на человеческий организм. Однажды он записал атаку чёрной мамбы на себя для школьного проекта подписчицы.

Осторожно, сцены в ролике могут шокировать

Порой в комментариях к видео собирались критики, обвинявшие Фриде в глупости, жестоком обращении с животными или фальсификации записи путём удаления у змей клыков. Он относился к такому с непониманием – «Что я такого сделал? Я никому не причинил зла». Последнее, впрочем, спорно. Зачастую змеи, которых использовал мужчина, были больны или находились в стрессовом состоянии.

Фриде не знает, добывали ли особей законно, но многие умирали через несколько месяцев после прибытия к американцу. Мужчина говорит о себе как о человеке, любящем природу, но его никогда не волновало, как долго проживёт змея после того, как он добудет из неё яд.

По словам Фриде, долгие годы научное сообщество относилось к нему скептически, хотя он всегда утверждал, что конечная цель его экспериментов – спасение человеческих жизней. Ради этого он неоднократно рисковал. Например, в ноябре 2015 года американец дал себя укусить сразу чёрной мамбе и тайпану. В записях американца он называет это одним из самых худших двойных укусов, с которыми он сталкивался.

На восстановление у него ушло четыре дня, а неделю спустя он повторил эксперимент с аналогичным результатом. «Не мог ходить. Всё тело горело. Падал много раз. Смерть была близко. Многому научился», – описывал впечатления мужчина. К тому времени он уже испытал на себе укусы двух видов гремучих змей, двух видов тайпана, четырёх видов кобры и всех видов узкоголовой и чёрной мамб.

Фриде держит фотографию со своей собакой и сыном сразу после укуса ядовитой кобры Фото Outside

Но эксперименты стоили Фриде личной жизни. По словам бывшей жены, увлечение мужа «разрушило их брак». Американец с этим не спорит, хотя продолжает дружить с бывшей супругой, а также двумя сыновьями 11 и 20 лет. Разведясь, он собрал свою лабораторию и переехал в частный дом в городе Фонд дю Лак, где жил в палатке. «Я пойму, как устроена смерть, а потом обыграю её. Только в этом я всегда был хорош», – поставил цель мужчина.

Встреча с иммунологом Гланвиллем стала для американца той отдушиной, которой ему не хватало после ухода жены и детей. Поверив, что вскоре их партнёрство поможет создать универсальный антидот, он уволился с работы водителем, которая приносила ему 50 тысяч долларов в год. Позже, осознав, что процесс движется гораздо медленнее, чем хотелось бы, он устроился развозчиком пиццы.

К октябрю 2018 года Фриде оказался в долгах, так что Гланвилль пригласил его пожить на ферме его семьи в Гватемале. Но американца не выпустили из США из-за долгов по алиментам.

Иногда змеи по какой-то причине не хотели кусать Фриде, как бы сильно он ни прижимал их к запястью и ни провоцировал. Тогда он выдавливал их яд в стаканчик, а потом закачивал его в шприц и делал себе укол. Это куда опаснее для организма, но американцу удавалось пережить и это. Порой он вовсе не чувствовал эффекта токсинов.

Прорыв, которого Фриде ждал почти 20 лет, случился в декабре 2018 года. Гланвилл и его коллеги сообщили, что готовы начать уникальное исследование – воспользоваться антителами американца для синтезирования антидота, способного остановить эффект ядов чёрной мамбы и техасского гремучника у мыши. Яд этих видов содержит протеины почти от всех 13 самых мощных токсинов, которые, как верят исследователи, можно нейтрализовать антителами Фриде.

На это Гланвилл и его команда запросили у Департамента здравоохранения США грант на 400 тысяч долларов ежегодно, включая зарплату для Фриде в 80 тысяч долларов. На момент написания статьи судьба гранта под вопросом. Несмотря на всплеск исследований о природе противоядий, проспонсированных Всемирной организацией здравоохранения, фармацевтические компании слабо заинтересованы в создании новых антидотов. В 2014 году гигант Sanofi Pasteur отказался от производства противоядий, что вынудило жителей большой части Африки искать лекарство от укусов в традиционной медицине.

Вскоре после новостей о гранте Фриде, спустя почти 20 лет, решил завершить эксперименты над собственным организмом. Он выполнил свою часть сделки, передав исследователям свои антитела.

В начале весны 2019 года мужчина признался журналисту Outside, что подумывает больше времени проводить с детьми. Сейчас он живёт со своей девушкой и собакой, а о былых экспериментах вспоминает только тогда, когда даёт интервью. За исключением случая в марте, когда он вместе с возлюбленной ухаживал за домашним неядовитым питоном друга. «Мою девушку укусил королевский питон. Я засмеялся. А потом меня дважды укусила водяная кобра».

Черная мамба: от паралича к смерти всего семь шагов | Заметки о животных

Черная мамба имеет очень ужасную репутацию. Впрочем, тут нет ничего удивительного — это одна из наиболее ядовитых и смертоносных змей в мире.

Также черная мамба является самой ядовитой змеей на всей территории африканского континента.

Что же касается прозвища «семь шагов», которым ее наградили местные жители, проживающие в Африке, то оно связано с очень высокой летальностью ее яда.

Очевидцы утверждают, что после укуса черной мамбы даже крепкие и здоровые мужчины не способны сделать более 7 шагов и умирают. Хотя наука приводит другие факты — чаще всего яд черной мамбы оказывает разрушительное действие на организм в течение 30-45 минут.

Черная мамба — самая быстрая наземная змея в мире, а также это самая длинная разновидность ядовитой змеи в Африке, и вторая по длине в мире.

Материал из Википедии — свободной энциклопедии

Средняя длина обычно составляет 2,5-2,7 метров, но длина тела отдельных особей может превышать 3 м. Эти гиганты могут жить до 11 лет.

Большая потенциальная опасность этой змеи была предметом многих африканских мифов и причиной тысяч человеческих смертей.

Что нам известно о черной мамбе

Начнем, пожалуй, с того, что это чрезвычайно ядовитая и очень быстрая змея. Она может развивать скорость около 12-14 км/ч. (на дальних дистанциях — до 20 км/ч). Убежать от нее очень проблематично.

Черная мамба — очень агрессивна, особенно когда ей угрожают, и известно, что она неоднократно кусает свою жертву (или обидчика), вводя большое количество яда с каждым новым укусом.

Его яд очень токсичен и, хотя существует противоядие, оно часто недоступно в южной и восточной Африке. Ежегодно от укусов черной мамбы умирает около 20 000 человек.

Отличительные черты

Вопреки своему названию, черная мамба на самом деле не черная, а чаще всего коричневого или оливкового цвета, но может иметь и сероватый окрас.

Собственно, эту опасную змею называют черной мамбой не за пигментацию ее кожи, а за окраску внутренней части рта, которая очень напоминает чернильные пятна.

Материал из Wikimedia Commons

Когда черной мамбе угрожает опасность, она открывает рот, чтобы показать свои «чернила» как предупреждающий знак для потенциального обидчика. В общем, пытается напугать, и очень часто у нее это хорошо получается.

Особенности поведения и привычки

Эти проворные змеи очень часто могут двигаться быстрее, чем большинство людей, что объясняет, почему в Африке их так сильно боятся.

Впрочем, многие ученые сходятся во мнении, что черная мамба использует свое преимущество в скорости, чтобы избежать угрозы, а не атаковать. Но тут, наверное, многое зависит от настроения ползучего гада.

Из Wikimedia Commons, свободного хранилища СМИ

И все же считается, что, как и другие ползающие, черные мамбы — очень застенчивые и скрытные змеи, которые предпочитают избегать конфронтации.

Тем не менее, они могут стать очень агрессивными, если им угрожают. Их защитное поведение является наиболее отличительной чертой.

Когда черной мамбе угрожают, она поднимает верхнюю часть тела над землей. Это ее оборонительная позиция.

Материал из Wikimedia Commons

Если змея вынуждена атаковать, чтобы защитить себя, то она не будет думать дважды: она будет вводить большие дозы яда с каждым укусом, громко шипеть и затем ускользать как можно быстрее в кусты.

Черная мамба обычно питается мелкими млекопитающими и птицами, хотя в некоторых районах Африки были обнаружены змеи с целыми попугаями или кобрами в их желудках.

Как черная мамба охотится

Черная мамба — засадный хищник, который выслеживает жертву преимущественно в дневное время.

К тому же, это еще и превосходный альпинист, который неподвижно поджидает удачного момента для скрытого и внезапного нападения, находясь на ветвях кустарников или деревьев.

Материал из Wikimedia Commons

Если атака не удалась с первой попытки, черная мамба будет преследовать добычу, используя свое преимущество в скорости на земле.

При охоте змея кусает свою жертву, вводя яд, впоследствии выпуская ее и следуя за ней, пока яд не начнет действовать, после чего съедает свой обед. Обычно жертва не остается в живых после укуса черной мамбы.

Эти змеи имеют очень гибкие челюсти, которые позволяют ей проглатывать пищу в четыре раза больше их головы. Но такая особенность присутствует у многих змей.

При встрече с черной мамбой у человека есть возможность выжить. Когда она только начнет поднимать свое тело над землей, в этот самый момент нужно бежать что есть мощи — чаще всего змея не будет преследовать.

Если же человек не успел слинять вовремя, то черная мамба его уже не отпустит. Такая вот она — с характером…

Пептиды из яда черной мамбы оказались эффективными анальгетиками

Яд черной мамбы, одной из самых ядовитых змей на планете, послужил для французских ученых материалом для поиска новых эффективных анальгетиков. Как выяснилось, короткие пептиды, входящие в состав этого яда, — а их назвали мамбалгинами — работают не хуже морфинов. Они блокируют протон-чувствительные ионные каналы в центральных и периферических нейронах, те, что отвечают на болевой стимул. Пока мамбалгины испытаны на мышах, но потенциально они могут избавлять от боли и людей; при этом к ним нет привыкания, как к морфию, нет и других неприятных побочных эффектов, свойственных сильным анальгетикам.

Поиск новых лекарств — это основное поле деятельности фармакологов. В этом им помогают физиологи и биохимики, разрабатывающие препараты на базе молекулярных моделей. Именно такие профессионалы из Института молекулярной и клеточной фармакологии (Вальбонн, Франция), Университета Ниццы — Софии Антиполис (Вальбонн) вместе с лабораторией LabEx (Вальбонн) и из Национального института здравоохранения и медицинских исследований (Клермон-Ферран) взялись за изучение работы протон-чувствительных болевых рецепторов и поиск новых эффективных анальгетиков.

Протон-чувствительные ионные каналы в нервных клетках реагируют на изменение рН. Казалось бы, концентрация протонов (рН) снаружи клетки всё время должна немного меняться. Кроме того, протон не может специфично связываться с какими бы то ни было веществами. Поэтому, когда в конце 70-х начале 80-х начались исследования протон-зависимых ионных каналов (с работами О. А. Крышталя и В. И. Пидопличко), ученые задавались вопросами, как вообще такие рецепторы могут функционировать. Сейчас дело немного прояснилось, и на повестке дня уже другие проблемы: чем занимаются эти вездесущие каналы и как их использовать.

Протон-чувствительные рецепторы расположены и в сенсорных нейронах, и в ЦНС, во всех тканях, в коже и внутри организма и, по-видимому, у всех хордовых, не исключая оболочников и бесчелюстных. Уже в начале их изучения выдвигалось предположение, что они связаны с передачей болевых стимулов, и сейчас это уже не гипотеза, а установленный факт (в настоящее время известны и многие другие функции этих каналов). Это означает, что ингибиторы протон-чувствительных каналов будут работать анальгетиками, а вещества, возбуждающие их, послужат алгогенами — стимуляторами боли. Естественно, фармакологам интереснее было искать анальгетики. И такие нашлись.

Их выделили из яда черной мамбы, одной из самых ядовитых змей на планете. Это два коротких пептида, состоящие из 57 аминокислотных остатков (два мамбалгина различаются всего одной аминокислотой). Они положительно заряжены и связываются со всеми известными типами протон-чувствительных ионных каналов, которые экспрессируются в центральной нервной системе. При этом они оказывают существенное влияния и на некоторые из рецепторов протон-чувствительных каналов в периферических нервных волокнах.

Действие мамбалгинов проверили в тестах на мышах. Сначала подтвердили их связь с протон-чувствительными рецепторами и каналами. Для этого сначала мышам делали инъекции мамбалгина вместе с налоксоном — антогонистом опиоидных рецепторов. Если бы новые анальгетики взаимодействовали с опиоидными рецепторами, как, например, морфины, то обезболивающий эффект оказался бы снижен по сравнению с контролем. Но оказалось, что налоксон не влияет на действие мамбалгинов. Если же тесты проводили на мышах с выключенными протон-чувствительными рецепторами — для этого использовали инъекции малых интерферирующих РНК (siРНК), останавливающих экспрессию этих ионных каналов, — то эффект существенно снижался. В действительности было показано, что организм по-разному отвечает на приостановку экспрессии разных протон-зависимых каналов в периферической и центральной нервной системе, на этой основе ученые начали дискуссию о функциональном значении каналов разных типов.

Как выяснилось, новые вещества действовали практически так же надежно, как и морфины, но в отличие от них не показали негативных побочных эффектов — моторных дисфункций и угнетения дыхания. Также очень важно, что к этим препаратам не зафиксировано привыкания.

Это исследование, помимо очевидной практической пользы, заставляет задуматься о важных эволюционных следствиях. Общепринято, что боль возникает как защитный механизм, оберегающий животное от смертельной опасности. Животное должно, реагируя на болезненные сигналы, обучиться или получить в наследство знание о таких опасностях. Хищник, участвующий в эволюционной гонке вооружений, пытается обойти этот химический сигнал. Его яд, снабженный сильным обезболивающим веществом, заставляет жертву становиться легкомысленней. Интересно, что черная мамба — это не единственный хищник, пользующийся подобным маневром. Уже упоминался яд тринидадского шеврона (Psalmopoeus cambridgei), в состав которого входит обезболивающее вещество. Также найдено обезболивающее вещество в стрекательном яде актиний. (Анальгетик из актиний открыт и изучен российскими специалистами, см. Андреев и др, 2009, и жаль, что об этой высококачественной научной работе не сообщалось в российских новостных лентах.) Создается впечатление, что ядовитые хищники без труда изобретают собственные средства для обезболивания, беря за основу различные биохимические каскады. Если в эволюционной гонке тот или иной признак востребован, то он непременно будет реализован.

Источники:
1) Sylvie Diochot, Anne Baron Miguel Salinas, Dominique Douguet, Sabine Scarzello, Anne-Sophie Dabert-Gay, Delphine Debayle, Valérie Friend, Abdelkrim Alloui, Michel Lazdunski, Eric Lingueglia. Black mamba venom peptides target acid-sensing ion channels to abolish pain // Nature. Published online 03 October 2012. Doi:10.1038/nature11494.
2) Полезная статья Пиотровского и др., 2007, в которой подробно и доступно описан биохимический механизм работы протон-чувствительных ионных каналов. Кроме того, описаны новые синтезированные пептидные и непептидные анальгетики, связанные именно с этим типом болевых рецепторов. Их эффективность выше, чем у привычных для нас анальгина и парацетамола.
3) Я. А. Андреев, С. А. Козлов, Э. П. Козловская, Е. В. Гришин. Анальгетическое действие пептидного ингибитора TRPV1-рецептора в моделях тепловой стимуляции боли (PDF, 210 Кб) // Доклады Академии наук. 2009. Т. 424. № 5. С. 688–691. (О новых анальгетиках из яда актинии.)

Елена Наймарк

Успешный исход острого отравления ядом зеленой мамбы (Dendroaspis viridis) клиническое наблюдение | Насибуллина

1. Ливанов Г.А., Батоцыренов Б.В., Лодягин А.Н., Адрианов А.Ю., Кузнецов О.А., Лоладзе А.Т., Баранов Д.В. Благоприятный исход острого тяжелого отравления ядом животного происхождения вследствие укуса моноклевой кобры. Клин. медицина. 2014; 92 (9): 70–72. PMID: 25790716

2. Ливанов Г.А., Батоцыренов Б.В., Лодягин А.Н., Андрианов А.Ю., Кузнецов О.А., Баранов Д.В., Неженцева И.В. Благоприятный исход лечения укусов змей семейства аспидовых. Общая реаниматология. 2015; 11 (2): 42–48. DOI: 10.15360/1813-9779-2015-2-42-48

3. Элленохорн М.Д. Медицинская токсикология: диагностика и лечение отравлений у человека. т.2. М.: Медицина; 2003: 1035. ISBN: 5-22503323-7

4. Линг Л.Л., Кларк Р.Ф., Эриксон Т.Б. Секреты токсикологии. М.: Бином; 2006: 376.

5. Bernheim A., Lorenzetti E., Licht A., Markwalder K., Schneemann M. Three cases of severe neurotoxicity after cobra bite (Naja kaouthia). Swiss Med. Wkly. 2001; 131 (15016): 227–228. DOI: 2001/15/smw-09731. PMID: 11400547

6. Орлов Б.Н., Омаров Ш.М., Гелашвили Д.Б., Корнева Н.В. Химия и фармакология змеиных ядов (обзор литературы). Фармакология и токсикология. 1979; 42 (2): 182–190. PMID: 374112

7. Tsetlin V.I. Snake venom alpha-neurotoxins and other «three-finger» proteins. Eur. J. Biochem. 1999; 264 (2): 281–286. DOI: 10.1046/j.14321327.1999.00623.x. PMID: 10491072

8. Kukhtina V.V., Weise C., Muranova T.A., Starkov V.G., Franke P., Hucho F., Wnendt S., Gillen C., Tsetlin V.I., Utkin Y.N. Muscarinic toxin-like proteins from cobra venom. Eur. J. Biochem. 2000; 267 (23): 6784–6789. DOI: 10.1046/j.1432-1033.2000.01775.x. PMID: 11082188

9. Bargar S., Johnson L. Mamba’s. Immediate first aid for bites by Western green mamba (Dendroaspis viridis). USA, Rourke Publishing Group; 1987: 24. ISBN 978-0-86592-960-9

10. Harvey A.L., Rowan E.G., Vatanpour H., Engström A., Westerlund B., Karlsson E. Changes to biological activity following acetylation of dendrotoxin 1 from black mamb. Toxicon. 1997; 35 (8): 1263–1273. DOI: 10.1016/S0041-0101(97)00016-0. PMID: 9278975

11. Wang F.C., Bell N., Reid P., Smith L.A., McIntosh P., Robertson B., Dolly J.O. Identification of residues in dendrotoxin K responsible for its discrimination between neural K+ channels containing Kv1.1 and 1.2 alpha subunits. Eur. J. Biochem. 1999; 263 (1): 222–229. DOI: 10.1046/j.14321327.1999.00494.x. PMID: 10429207

Министерство здравоохранения

Отравления змеиным ядом изучаются таким разделом медицины, как клиническая токсикология. Владеть информацией о правилах проведения мероприятий по оказанию неотложной помощи и методах профилактики их укусов должны не только медики, но и те, кто трудится в сельскохозяйственной отрасли,  часто бывает на природе или путешествует. О том, как уберечь себя от укусов змеи и что делать, если это уже произошло, рассказал главный внештатный  травматолог – ортопед, заместитель главного врача по хирургии Ульяновского областного клинического центра специализированных видов медицинской помощи Олег Сорокин.

Все ли пресмыкающееся опасны для человека?

Ежегодно от укусов змей страдает около 2 миллионов человек, из которых погибает около 110-120 тысяч.  На территории России, Республики Беларусь и Украины обитает около 11 видов ядовитых змей, которые опасны для людей. Наиболее распространены семейства ужеобразных, аспидовых, гадюковых и ямкоголовых. Многие ужи совершенно не опасны для людей, не агрессивны и нападают только при преднамеренно агрессивном отношении человека. Их яд выделяется из зуба, который расположен глубоко во рту и поражает только жертву, находящуюся во рту пресмыкающегося. Иначе обстоит дело с гадюками и другими видами ядовитых змей: они всегда агрессивно настроены к любому вторжению человека в их среду обитания. Для провокации атаки с их стороны бывает достаточно одного присутствия человека или животного. Именно поэтому в местах их обитания следует вести себя крайне осмотрительно и сразу обходить стороной замеченное пресмыкающееся. Бывают и такие случаи, когда момент укуса змеи остается незамеченным вплоть до появления первых признаков отравления ядом или выявления следов прокуса кожи.

Чем опасен укус змеи?

Змеиный яд представляет собой сложное по составу вещество, которое состоит из набора белков и биологически активных компонентов, оказывающих косвенное или непосредственное токсическое воздействие на системы и органы человека. Обычно змея нападает на человека или животное только при самозащите и около 70% случаев укусов приходятся на поражение ног. Агрессивность змей возрастает во время брачного периода или линьки, но факт укуса змеей не всегда вызывает отравление организма. Например, при укусе гадюки змея в 25% случаев не выделяет яд, а коралловые змеи и кобры – примерно в 50%.

Наиболее тяжело отравление змеиным ядом протекает при алкогольном опьянении, высокой температуре воздуха, у людей с сопутствующими заболеваниями, лиц с небольшой массой тела и при введении яда в область шеи, головы или крупного кровеносного сосуда. А наиболее опасными являются укусы крупных змей. Самым опасным для человека является укус черной мамбы, обитающей в центральной, восточной и южной части африканского континента. Эта змея во время нападения способна развивать скорость до 20 км в час и летальный исход после ее укуса наблюдается в 95-100% случаев. Наиболее чувствительны к укусам змей дети и люди пожилого возраста. У них укусы даже самых слабых змей могут привести к молниеносной смерти. Сопутствующая патология значительно отягощает токсическое действие яда. Интенсивные движения и бег ускоряют кровообращение и способствуют быстрому распространению яда по всему организму.

Какова симптоматика после укуса?

Можно сразу заметить следы от укуса в виде двух ранок треугольной формы, расположенных на одном уровне, сильное жжение и боль в месте укуса, покраснение и выраженный отек окружающих рану тканей, синюшные или темные пятна и волдыри на коже возле ран от укуса, кровянистые выделения из мест укуса.

Кроме того, наблюдается и общее расстройство организма — тахикардия (частое сердцебиение – 95-120), падение артериального давления, возможно до критического уровня, боли в грудной клетке, неврологические нарушения, мышечная слабость, помрачение сознания, двоение в глазах и невозможность концентрации взора, онемение тела, особенно в области укуса, повышение температуры, боли в мышцах. Степень выраженности симптомов зависит от многих факторов, в том числе от вида, возраста и размеров змеи. В этом отношении самыми опасными являются кобры, аспид, гремучие змеи. Гадюки относительно них менее ядовиты, хотя также вызывают серьёзные отклонения. Молодые и маленькие змеи менее опасны.

Чаще всего поражаются конечности, но иногда повреждаются и другие места. В первом случае симптомы развиваются медленнее, чем в случае локализации укуса на туловище, шее, лице или в области сосудов.

Чем опасен укус конкретных видов ядовитых змей?

Укусы большинства видов змей, обитающих на наших территориях крайне редко приводят к гибели пострадавших. Хотя общетоксические реакции с угрозой здоровью развиваются довольно часто. Основной опасностью является образование обширных гнойных ран в месте укуса змеи. В данной ситуации эффективной является адекватно проведенная антитоксическая терапия. Существуют и те виды змей, укус которых способен вызвать молниеносную смерть.

Укусы кобры характеризуются сильной болезненностью. В таких случаях развивается гемолитическая желтуха и печеночная недостаточностю. На спасение жизни времени так же не много, что требует неотложной госпитализации. Укусы ямкоголовых и гремучих змей характеризуются сильной болью и жжением в месте укуса. Очень быстро нарастает и прогрессирует отек пораженного сегмента, захватывая удаленные от первичного очага участки. Существует угроза возникновения внутренних кровотечений из желудочно-кишечного тракта.

Как правильно оказать первую медицинскую помощь пострадавшему?                                                    

От своевременности оказания первой помощи и полноты её объема зависит многое. Поэтому нужно соблюдать чёткий алгоритм, благодаря которому можно не только спасти жизнь пострадавшему, но и минимизировать риск для здоровья. Ни в коем случае нельзя паниковать. Только спокойно и целенаправленно можно оказать действительно эффективную помощь.

Необходимо:

- Успокоить пострадавшего и уложить в горизонтальное положение. Это замедлит кровоток и распространение яда. Если змея фиксирована к коже после укуса, её незамедлительно отнимают. Чем меньше длительность контакта, тем меньше количество выделенного яда.

-Снять с конечности все украшения для предупреждения сдавления тканей при нарастании отека.

-Обеспечьте обездвиживание  укушенной области подручными средствами или импровизированной шиной. Наложите сдавливающую повязку выше укушенной области. Также необходимо обильное питье. Это уменьшит концентрацию попавших в кровь токсинов.

-При развитие молниеносных токсических и шоковых реакций показаны реанимационные мероприятия по восстановлению проходимости дыхательных путей и непрямой массаж сердца.

-Крайне желательно по возможности убить или точно идентифицировать змею. Если нет возможности сделать это, за больным наблюдают. Отсутствие боли, отека и каких-либо местных или общих проявлений является свидетельством укуса неядовитой змеи. Если четко известно, что змея ядовитая – мероприятия начинают незамедлительно.

Чего не стоит делать?

Употреблять алкогольные напитки, производить надрезы кожи в области отека за исключением мест укусов, прижигать место укуса — это не даёт результатов, лишь увеличивает площадь раневой поверхности, накладывать теплые компрессы. Массивно обкладывать конечность льдом, так как это приводит к дополнительному нарушению кровоснабжения в пораженном сегменте. Если и оказывать местную гипотермию, то только в зоне самого укуса.

Для разрушения яда, циркулирующего в системном кровотоке необходимо введение антитоксичной сыворотки. Она представляет собой поливалентные (многокомпонентные) антитела против действия различных компонентов яда большинства видов змей. Они нейтрализуют токсины. Доза выбирается индивидуально в зависимости от тяжести состояния и вводится поэтапно во избежание анафилактических реакций.

Существует ли профилактика от укуса змеи?

Специфической профилактики от укусов ядовитых змей не существует. Неспецифические сводятся к ношению длинных брюк и высоких сапог или ботинок при пребывании в районах, где зафиксировано распространение змей. Необходимо также соблюдать осторожность и внимательность при ходьбе. Любую незнакомую змею следует считать ядовитой. Заметив змею или услышав предупреждающее шипение, надо замереть, дать змее возможность уползти. От змеи, принявшей позу угрозы, надо уйти, медленно отступая назад, избегая резких движений. Недопустимо защищаться выставленными вперед руками. Очень важно сохранять спокойствие в действиях, решениях, жестах. Опасна невидимая змея, обнаруженная змея опасности не представляет.

При содействии Центра медицинской профилактики и формирования здорового образа жизни

американец 20 лет экспериментировал с укусами ядовитых змей

Укус некоторых ядовитых змей способны убить человека за пару часов. После атаки таких рептилий, как тайпан, черная мамба и королевская кобра не всегда могут спасти даже высококвалифицированные медики с полным набором медикаментов и специального оборудования. Но 51-летний американец Тим Фриде (Tim Friede) сделан совсем из другого теста — после укуса любой из этих змей он испытывает лишь недомогание и даже не обращается к врачам.

Такая невероятная способность далась Тиму нелегко. Способность переносить укусы самых ядовитых гадов планеты у него неврожденная, а приобретенная долгими годами «тренировок», если это можно так назвать. У Фриде есть одна примета — если в течение 15 минут после укуса черной мамбы его сердце не остановится — то все будет в порядке и можно ни за что не переживать.

Тим никогда не видел своих настоящих родителей, так как вырос в семье, взявшей его из приюта. Детство его прошло в Милуоки, штат Висконсин, среди густых лесов и озер. Вокруг всегда хватало мелкой живности, но Тим всегда интересовался лишь змеями и пауками.

Парень мечтал служить в спецназе, но полученные в подростковом возрасте травмы закрыли перед ним путь в спецподразделения. Фриде окончил школу и устроился мойщиком окон в небольшую клининговую компанию . Лишь в 30 лет он задумался о том, чем бы хотел на самом деле заниматься в этой жизни.

Тут парень и вспомнил свое детское увлечение опасными тварями. Оставив швабру и ведро, Тим записался на курсы сборщиков ядов, чтобы посвятить себя без остатка поиску эффективных антидотов от укусов опасных животных. изучив теорию, мужчина выбрал для себя самый опасный путь — стал специализироваться на змеиных ядах.

Первый смертельно опасный эксперимент на себе Фриде поставил 12 сентября 2001 года, на следующий день после американской национальной трагедии. Во время атаки террористов на башни Всемирного торгового центра погибла подруга Тима, что стало причиной тяжелой депрессии.

Изрядно выпив, Тим нарушил все мыслимые правила и попытался получить яд у египетской кобры, но животное сумело укусить его в средний палец. Спасло собирателя ядов то, что до этого он год делал себе инъекции змеиного яда, чтобы выработать иммунитет к смертельным для любого человека токсинам.

Фриде не только не умер, но и чувствовал себя настолько бодро, что отправился в гостиную, чтобы рассказать о случившемся своей жене и шестилетнему сыну.

Это изменило мою жизнь. В тот день я впервые победил смерть.

Всего через час, Тим вернулся в свой подвал и взял в руки моноклевую кобру. Змея укусила его в правый бицепс и на этот раз удача отвернулась от Фриде. Он оказался полностью парализован и слышал, как прибывшие по вызову его супруги медики спорили, жив он или уже нет.

Четыре дня Тим пролежал в коме, подключенный к системам жизнеобеспечения, а чтобы окончательно избавиться от действия яда, понадобилось четыре флакона противозмеиной сыворотки. Сейчас экспериментатор вспоминает, что ему было очень страшно и он не хотел бы повторения этого сурового урока. Но в то же время Фриде признается, что будучи прикованным к больничной койке, он пообещал себе, что обязательно добьется успеха и сможет выдерживать два укуса за один день, не обращаясь за медицинской помощью.

Чтобы добиться поставленной цели, мужественному американцу нужно было выработать в организме достаточное количество антител, которых у обычного человека нет. Те, кого кусала змея один-два раза, имеют некоторый иммунитет, но большинство людей в мире не сталкивались с такими проблемами и абсолютно не защищены от ядов.

Фриде приобрел множество ядовитых змей и расположил их в специально оборудованном для этих целей подвальном помещении своего дома. Мужчина не комментирует то, как ему удалось провернуть это в стране, где существует строгий контроль над опасными тварями и многие животные просто запрещены к содержанию частными лицами.

Запасшись материалом для работы, неугомонный исследователь принялся колоть себе разные змеиные яды, как отдельно, так и сочетая друг с другом. Все свои впечатление Тим подробно записывал, так как совершенно очевидно, что его, не имеющие аналогов опыты над собой, представляют большую ценность для науки.

Иногда змеи по какой-то причине не хотели кусать Фриде, как бы сильно он ни прижимал их к запястью и ни провоцировал. Тогда он выдавливал их яд в стаканчик, а потом закачивал его в шприц и делал себе укол. Это куда опаснее для организма, но американцу удавалось пережить и это. Порой он вовсе не чувствовал эффекта токсинов.

Так описывают журналисты работу Фриде с самыми опасными на планете пресмыкающимися.

Ученые мужи вскоре заметили старательного токсиколога-самоучку и явились к нему, в лице Джейкоба Гланвилла (Jacob Glanville), молодого и очень амбициозного иммунолога. В 2017 году два фаната ядов встретились и поняли, что отлично друг друга дополняют. Гланвилл увидел в опытах Фриде огромный потенциал и решил сделать себе имя в науке, воспользовавшись опытом Тима.

Мужчины заключили сделку, согласно которой Джейкоб получает антитела из крови Фриде, для создания революционного противоядия. Доход от предприятия должен был составить миллионы долларов и его договорились делить пополам.

Следующий год прошел в экспериментах, под которые уже была подведена научная основа. Фриде регулярно кусали змеи и он так привык к этому, что даже завел особые предпочтения. Храбрец предпочитал водяных кобр, в яде которых содержался компонент, блокирующий нервные клетки. Таким образом получалась своеобразная местная анастезия, делающая укус не таким болезненным. Наиболее неприятными были укусы гремучих змей и капских кобр, так как токсины их яда растворяли мышцы.

Вскоре мужчина завел свой YouTube-канал, где показывал контролируемые укусы змей и описывал свои впечатления. Фриде и сейчас с удовольствием отвечает на вопросы подписчиков, а однажды даже записал атаку черной мамбы для школьного проекта одной своей юной поклонницы.

Немало у Фриде и хейтеров, собирающихся в комментариях под видео, чтобы выразить свое возмущение. Претензии к Тиму у людей разные, начиная от обвинений в издевательствах над животными и заканчивая обвинениями в подлоге. Защитники природы утверждали, что змей Тим получает незаконно, покупая у браконьеров. Также многие были уверены, что рептилии недолго гостят в подвале Фриде и, выполнив свою функцию, умирают от истощения и отсутствия должного ухода.

Но Фриде, невзирая на упреки недоброжелателей, как танк шел напролом к своей цели. Долгое время его не воспринимали в научных кругах всерьез, считая неким очень рисковым фриком. Но, когда Тим начал демонстрировать невероятную стойкость к ядам, давая себя одновременно кусать тайпану и черной мамбе или двум тайпанам, то о нем заговорили с уважением.

К сожалению, увлечение американца разрушило его семью — жена с двумя сыновьями ушла от него, не выдержав бесчеловечных экспериментов Тима над собой. Несмотря на это, они остались хорошими друзьями и Фриде проводит немало времени со своими сыновьями, которым сейчас 16 и 20 лет.

Но опасный труд не спешил обогащать Фриде и Гланвилла. Тим, поверив в скорый успех, уволился из транспортной компании, где в год зарабатывал до 50 тысяч долларов. Оставив при разводе дом жене и детям, он был вынужден переехать из Милуоки в провинциальный город Фонд дю Лак, где стал снимать небольшой дом. Сам он жил в палатке во дворе, а его питомцы занимали лучшие помещения в арендованном жилище.

Чтобы свести концы с концами, в свободное от своей научной работы время, мужчина подрабатывал развозчиком пиццы. К началу 2018 года Тим был по уши в долгах и уже не мог себя обеспечить без посторонней помощи. Гланвилл, видя бедственное положение компаньона, предложил ему переехать в Гватемалу, где его родственники держали ферму.

Но Фриде не мог воспользоваться приглашением, так как его не выпускали из страны из-за большого долга по алиментам. Вскоре Гланвилл с коллегами сумели выделить антитела из крови Тима и заявили публично о готовности начать тестирование антидота на  подопытных животных.

Чтобы иметь возможность осуществить задуманное, Гланвилл просил у Департамента здравоохранения США 400 тысяч долларов в год, в которые входили также и 80 тысяч зарплаты для Фриде. Но чиновники совсем не проявили заинтересованности в многообещающем проекте и уже год как рассматривают обращения ученого, ничего ему не обещая, но и не отказывая.

Хотя ВОЗ и старается развивать программы, связанные с оказанием помощи пострадавшим от укусов ядовитых змей, крупные фармацевтические компании не спешат приступать к выпуску противоядий. Более того, в 2014 году с рынка противозмеиных сывороток ушла Sanofi Pas­teur — крупнейшая и наиболее авторитетная в этой области компания. Это событие в буквальном смысле оставила жителей большинства стран Африки беззащитными перед ядовитыми животными.

Сам Тим Фриде устал за 20 лет от опытов над собой и не так давно заявил, что выходит из проекта. По его словам, он предоставил ученым достаточно образцов крови с антителами, чтобы те могли обходиться в дальнейшем без него. То есть, свою часть сделки он выполнил полностью и может теперь ждать дивидендов со своей многолетней опасной работы.

С начала 2019 года Тим больше не имеет дел с ядовитыми гадами и старается больше уделять времени своей девушке и детям. О своих экспериментах мужчина вспоминает, лишь когда дает интервью журналистам.

Смотрите также: Миллионы на хобби: как английская пенсионерка стала повелительницей змей

А вы знали, что у нас есть Instagram и Telegram?

Подписывайтесь, если вы ценитель красивых фото и интересных историй!

Ядовитую железу змей впервые вырастили в лаборатории — Наука

ТАСС, 23 января. Биологи из Нидерландов превратили стволовые клетки змей в искусственный аналог их желез, в которых вырабатывается яд. Создание подобных желез значительно ускорит появление новых лекарств и противоядий, пишут ученые в научном журнале Cell.

«Каждый год от укусов змей умирает свыше ста тысяч человек, большая часть которых – в развивающихся странах. При этом технологии производства противоядий почти не поменялись с XIX века. Абсолютно ясно, что на подобные лекарства существует спрос, который сейчас ничем не удовлетворен», — рассказал один из авторов работы, молекулярный биолог из Утрехтского университета (Нидерланды) Ганс Клеверс.

Яды и токсины многих грибков, змей, рыб и микробов сейчас активно используются в качестве компонентов разных лекарств, лабораторных реактивов и в самых разных других целях. В частности, несколько лет назад французские биологи использовали яд черной мамбы для создания мамбалгина, очень эффективного обезболивающего, котороые не вызывает зависимости.

Их российские коллеги, в свою очередь, нашли другой мощный анальгетик в щупальцах морских полипов – актиний, а также обнаружили в яде морских улиток-конусов очень быстрый аналог инсулина. Все эти вещества, как надеются ученые, помогут создать более эффективные или уникальные лекарства в самое ближайшее время.

Змея в пробирке

Клеверс и его коллеги выяснили, как можно резко ускорить процесс изучения, поиска и даже создания подобных молекул, экспериментируя со стволовыми клетками южноафриканской щитковой кобры (Aspidelaps lubricus) – ядовитой змеи, чей укус опасен для человека, но далеко не всегда становится причиной смерти. Для этих экспериментов ученые использовали несколько оплодотворенных яиц кобры.

«Мы опасались, что не сможем выделить стволовые клетки из будущих ядовитых желез зародышей, так как мы не знали, как они выглядят. Оказалось, что это не было проблемой — клетки начали сразу же делиться и формировать структуры. Более того, аналоги ядовитых желез росли так быстро, что уже через неделю их можно было разделить на части и начать выращивать заново», — продолжает Клеверс.

Биологи превратили эти культуры в полноценные аналоги ядовитых желез змеи, обработав стволовые клетки особым «коктейлем» из сигнальных молекул. Они заставили стволовые клетки превратиться в нужные компоненты ядовитых желез. Чтобы запустить этот процесс, ученые понизили температуру питательной среды с привычных для млекопитающих 37  до 32 °C.

Последующие опыты показали, что миниатюрные копии ядовитых желез щитковой кобры росли очень быстро и производили большие количества яда. Его работу биологи проверили на культурах мышечных клеток мышей и нейронах крыс. Эти успехи заставили ученых вырастить аналогичные органоиды из зародышевых телец ряда других змей, в том числе капских кобр (Naja nivea), одной из самых ядовитых и опасных рептилий Африки, а также техасских гремучников (Crotalus atrox) и прочих опасных змей Нового Света.

Уже сейчас, как отмечают исследователи, подобный подход работает гораздо быстрее, чем выращивание и «доение» змей на фермах. Кроме того, он дешевле, чем производство яда или противоядий при помощи пересадки генов змей в геном микробов и дрожжей. Сейчас нидерландские биологи создают своеобразную «библиотеку» из 50 типов подобных искусственных ядовитых желез разных видов змей. Работа с ней поможет медикам спасать жизни многих тысяч людей, укушенных этими рептилиями, заключают Клеверс и его коллеги.

Неожиданный случай укуса черной мамбы (Dendroaspis polylepis) в Швейцарии

Мамбы (род Dendroaspis ) — одни из самых страшных ядовитых африканских змей. Без лечения укусы мамбы часто заканчиваются смертельным исходом. Первая помощь включает лимфатическую задержку с применением техники иммобилизации давлением. Медицинское лечение включает постоянный мониторинг, обеспечение проходимости дыхательных путей, обеспечение адекватной вентиляции, симптоматические меры и введение конкретных противоядий.Мы сообщаем о необычном случае, когда заводчик змей укусила черная мамба в Швейцарии, сообщаем о клиническом течении болезни и рассматриваем меры по спасению жизни при укусах мамбы. Этот случай подчеркивает важность раннего введения противоядия и предполагает, что врачи неотложной помощи и интенсивной терапии, а также лица, оказывающие первую помощь во всем мире, должны быть знакомы с клинической токсинологией укусов экзотических змей, а также с логистикой для наиболее быстрого предоставления конкретного противоядия. .

«Змея сначала кусает укротителя».
Румынская пословица.

1. Введение

Dendroaspis polylepis (черная мамба) — одна из самых опасных змей в мире. Без лечения укусы мамбы часто заканчиваются смертельным исходом [1]. Поскольку укусы мамбы в Европе редки [2–5], лечение может быть сложной задачей, особенно если быстрое введение противоядия не дает результатов [6]. Мы сообщаем о случае, когда швейцарский заводчик змей был укушен черной мамбой, сообщаем о типичном клиническом течении болезни и рассматриваем лечение нейротоксических укусов змей.

2. Изложение клинического случая

Письменное информированное согласие на публикацию было получено от пациента.

Во время кормления 5-летнего самца черной мамбы 34-летний заводчик змей внезапно заметил крошечную кровавую отметину на его предплечье и одновременно легкое покалывание в губах. Он сразу понял, что его укусили, и позвал друга-эксперта по змеям за советом. Таким образом, пациент смог предоставить первым респондентам подробную информацию о змее и о том, где можно получить соответствующее противоядие. Он приказал жене наложить давящую повязку на предплечье. В течение следующих пяти минут возникли стеснение в груди, генерализованная парестезия и фасцикуляция. По прибытии в скорую помощь пациент не мог ходить, страдал тахипноэ и выраженной дизартрией. Предполагая наличие сопутствующей аллергической реакции, парамедики назначили метилпреднизолон, клемастин и адреналин, прежде чем доставить пациента в ближайшую больницу. Тем временем швейцарская вертолетная машина скорой помощи забрала противоядие на одном из 8 национальных складов противоядия.

Через сорок минут после укуса пациент прибыл в отделение неотложной помощи с жалобами на ухудшение фасцикуляций и парестезии конечностей и лица. При физикальном обследовании он был полностью в сознании с частотой сердечных сокращений 105 в минуту и ​​кровяным давлением 165/80 мм рт. У него было тахипноэ со скоростью 30 ударов в минуту. Пульсоксиметрия показала насыщение кислородом воздуха помещения 95%. На левом предплечье обнаружены две крошечные колотые раны с местным отеком и покраснением. Двигательная функция была нормальной, за исключением легкого птоза.Через семьдесят минут после укуса пациенту дали 2 флакона (20 мл) «Поливалентного змеиного яда SAMIR» вместе с 2,5 мг мидазолама внутривенно для продолжающейся гипервентиляции. После этого пациент был переведен в наше отделение интенсивной терапии третьего уровня для дальнейшего лечения.

По прибытии в отделение интенсивной терапии пациент был гемодинамически стабильным, но все еще имел тахикардию и тахипноэ. Немного улучшились фасцикуляции, дизартрия и птоз. ЭКГ показала атриовентрикулярную блокаду 1 степени без каких-либо других отклонений.Первоначальные лабораторные анализы без особенностей, за исключением умеренного респираторного алкалоза. В течение следующих нескольких часов появились потливость, озноб, затруднение глотания, а также тошнота. Однако дыхательные пути никогда не были нарушены, кашлевый рефлекс сохранен, а дыхательной недостаточности не было. Поэтому, из-за первоначальных опасений по поводу возможной аллергической реакции, мы решили не применять противоядие в дальнейшем. На следующий день симптомы отравления улучшились, но у пациента развился целлюлит укушенного предплечья и рабдомиолиз с пиковым уровнем креатинкиназы в сыворотке крови 16049 Ед / л.После лечения внутривенным введением жидкости и амоксициллина / сульбактама его состояние постепенно улучшилось. После четырех дней пребывания в больнице он был выписан домой с мышечной болью в качестве единственного остаточного симптома. Через несколько недель пациент полностью выздоровел.

3. Обсуждение

Укусы змей Dendroaspis в Европе редки. В 1987 г. Марквальдер и Коллер [2] описали два случая укусов Dendroaspis viridis (зеленой мамбы). Во Франции одна жертва пережила укус зеленой мамбы, хотя введение противоядия не удалось [6].Укусы черной мамбы были зарегистрированы в Германии [3] и в Чехии [4]. Насколько нам известно, наш случай является третьим зарегистрированным укусом черной мамбы в Швейцарии и первым из опубликованных случаев.

Яд черной мамбы очень нейротоксичен и содержит комбинацию α -нейротоксинов, которые вызывают постсинаптическую блокаду нервно-мышечных соединений, и дендротоксинов, которые ингибируют потенциал-зависимые калиевые каналы, увеличивая высвобождение ацетилхолина в нервно-мышечном соединение, тем самым создавая нервно-мышечный блок, аналогичный блоку деполяризации [7, 8]. Напротив, фасцикулины действуют как ингибиторы ацетилхолинэстеразы, тем самым увеличивая доступность ацетилхолина в нервно-мышечном соединении и создавая генерализованные длительные фасцикуляции [9]. Кальцисептин, еще один компонент яда, подавляет сокращение гладких мышц и сердечную функцию, блокируя кальциевые каналы L-типа [10]. Яд обычно не вызывает деструкцию и некроз тканей [11, 12], так как он не обладает значительной протеазной активностью [13], хотя он содержит низкий процент других белков, таких как металлопротеиназа, гиалуронидаза, прокинетицин, фактор роста нервов, рост эндотелия сосудов фактор, фосфолипаза А2, 5′-нуклеотидаза и фосфодиэстераза [7].

Симптомы после укуса мамбы могут проявиться в течение 10 минут [13]. Ощущение покалывания в месте укуса может быть единственным начальным признаком отравления [14]. Другие неврологические симптомы включают миоз, птоз, помутнение зрения, бульбарные симптомы, парестезию, фасцикуляции, атаксию и потерю сознания. Общие признаки отравления могут включать местную боль, тошноту, кашель и обильное потоотделение из-за чрезмерной стимуляции симпатической нервной системы. В тяжелых случаях может потребоваться интубация, искусственная вентиляция легких и поддержка кровообращения [4].

Первая помощь включает в себя успокоение пациента, снятие стягивающих украшений и замедление лимфатической системы с помощью техники иммобилизации давлением. Часто случаются множественные укусы, так как мамбы могут наносить удары неоднократно. Бинт накладывают, начиная с проксимального места укуса, чуть выше пальцев рук или ног, и покрывают всю конечность. Рекомендуется последующая иммобилизация шиной [15]. Повязку не снимают до введения противоядия [16]. Жгут не рекомендуется.

Краеугольным камнем медицинского лечения является обеспечение проходимости дыхательных путей и адекватной вентиляции, обеспечение поддержки кровообращения при необходимости и внутривенное введение определенного противоядия [17]. Лечение противоядиями следует рассматривать всякий раз, когда отравление мамба диагностируется по наличию системных или неврологических признаков, описанных выше. Отсутствие следов клыков не исключает отравления. С другой стороны, наличие следов клыков это не подтверждает, так как могут возникнуть сухие укусы.Рекомендуемая начальная доза поливалентной антисыворотки SAIMR составляет 20 мл (2 флакона) [18]. Дополнительное количество противоядия (до пяти раз превышающее начальную дозу) следует титровать с учетом признаков и симптомов отравления. Лечение противоядиями эффективно даже тогда, когда нейротоксические эффекты стали достаточно выраженными [19]. Поэтому не существует верхнего предела времени для введения противоядия [20].

Противоядие не лишено рисков. IgE-опосредованные аллергические реакции, включая явную анафилаксию, могут возникать как на противоядие, так и на сам яд [21].Возникают отсроченные реакции (в течение 6–21 дня после контакта), такие как крапивница и сывороточная болезнь [22]. Однако, учитывая плохой прогноз нелеченого укуса мамбы, даже анафилактический ответ не является противопоказанием к применению противоядия. В таких случаях инфузию противоядия следует временно прекратить, и состояние пациента должно быть стабилизировано, прежде чем инфузия противоядия будет возобновлена ​​более медленными темпами. Внутривенная тестовая доза 1 мл, разведенная в 9 мл физиологического раствора, может использоваться у пациентов с высоким риском аллергических реакций.Ограниченные данные подтверждают профилактическое использование адреналина перед назначением противоядия [23, 24]. Нет никаких доказательств для предварительного лечения антигистаминными препаратами или кортикостероидами [25, 26].

У нашего пациента основными клиническими симптомами были фасцикуляция, мышечные сокращения, бульбарный паралич и рабдомиолиз. Дыхательной недостаточности не было по трем возможным причинам. Первая причина — это немедленное осознание пациентом укуса и образцовая первая помощь, включая давящую повязку и физический отдых.Во-вторых, хотя яд дозирующий гипотеза спорным [27] количество яда вводили, вероятно, субмаксимальной, как укус, скорее всего, оборонительный. В-третьих, быстрая доступность противоядия предотвратила дальнейшее ухудшение состояния, особенно дыхательную недостаточность. Однако клиническое течение, вероятно, было бы более тяжелым, если бы сам пациент не отреагировал так быстро. В нашем отчете подчеркивается важность раннего введения противоядия. Поэтому врачи неотложной помощи и реанимации, а также лица, оказывающие первую помощь во всем мире, должны быть знакомы с клинической токсинологией укусов змей и с логистикой, чтобы как можно быстрее сделать конкретное противоядие доступным.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов в отношении публикации этой статьи.

Правдивые факты о Черной Мамбе

Правдивые факты о Черной Мамбе

Печально известная Черная Мамба (Dendroaspis polylepis) часто считается самой смертоносной змеей в мире и не без оснований. Это большая и активная змея, которая будет двигаться довольно быстро, оторвав до трети своего тела от земли.Если загнать в угол, он, как известно, наносит несколько ударов в быстрой последовательности, вводя большое количество очень сильнодействующего нейротоксического яда. Смерть человека при необработанных укусах может длиться от 3 до 16 часов, но при серьезных укусах жертвы могут испытывать серьезные проблемы с дыханием менее чем за полчаса.

Черная мамба на самом деле не агрессивная змея и очень быстро избегает людей, если ей дается шанс, а укусы этой змеи довольно редки, тем более, по сравнению с укусами таких змей, как мозамбикская плюющаяся кобра и гадюка .

Как дома, на деревьях, так и на земле, Черная Мамба активна в течение дня, когда охотится на такую ​​добычу, как грызуны, белки, даманы, маленькие антилопы и молодые птицы. Он любит купаться и часто возвращается на одно и то же место каждый день. Но если опасность присутствует, она быстро исчезнет в густом кустарнике, в ближайшей яме или в расщелине скалы. Черная мамба откладывает 6-17 яиц летом, а молодые вылупляющиеся детеныши достигают 40-60 см в длину и ядовиты с момента выхода из яиц.Молодые мамбы очень нервны, их редко можно увидеть и, как говорят, они быстро растут в первый год, достигая даже 2 м в длину. Самцы часто вступают в драку во время брачного сезона, и их можно увидеть, как они крутятся вокруг друг друга, пытаясь повалить своего противника на землю.

Цвет
Черная мамба редко бывает черного цвета. Его общий цвет обычно оливково-зеленый, темно-оливковый, серовато-коричневый, светло-серый или темно-серый, иногда с более темными пятнами, которые могут образовывать косые полосы по бокам.Но некоторые старые особи вполне могут быть очень темного цвета и на расстоянии казаться черными. Молодые особи обычно имеют цвет от светло-серого до средне-серого, со светлым брюшком. Внутренняя часть рта черной мамбы обычно темно-черного цвета, но могут встречаться и люди со светлым ртом. При угрозе змея быстро отступает в позицию для удара, может образовывать узкий капюшон и открывать пасть, обнажая черную внутренность.

Длина
О длине Черной Мамбы много говорилось, и социальные сети наводнены сообщениями о монстрах-мамбах, которые были либо убиты, либо захвачены и предположительно точно измерены.

Размер Черной Мамбы часто преувеличивают, и истории о 6-метровой Черной Мамбе — обычное дело. В литературе говорится, что она достигает максимальной длины 4,5 м, но за последние 30 с лишним лет самая длинная черная мамба, точно измеренная, составляла 3,8 м.

В некоторых случаях кусок веревки использовался для измерения змеи, или ширины дороги, или даже маркеров на поле, которые затем можно было измерить позже. За прошедшие годы было проведено множество исследований черной мамбы не только в Южной Африке, но и во всем ее ареале.Образцы были точно измерены рядом ученых, а некоторые образцы были депонированы в музейные коллекции, где они все еще доступны для дальнейшего изучения.

В своей книге « FitzSimons Snakes of Southern Africa » Бродли, признанной во всем мире авторитетной книгой о змеях Южной Африки, Бродли упоминает, что черная мамба может достигать 4,3 м в длину «в исключительных случаях». В «Змеях Уганды» Питмана максимальная длина равна 3.048 м, но также говорит, что эта змея «может в исключительных случаях достигать 4,267 м». Ионид (Человек-Змея), который, вероятно, поймал больше змей в Африке, чем кто-либо другой, о котором я знаю, упоминает максимальную длину в 3,2 м в Танзании. В Опасные змеи Африки Спаулза и Бранча они говорят о необоснованных сообщениях о Черной Мамбе длиной 4,3 метра, в то время как Виссер и Чепмен в книге Змеи и Змеиный укус (1978) говорят, что Черная Мамба может достигать только 3,6 метра. В книге A Field Guide to Snakes and Other Reptile of Southern Africa Билл Бранч упоминает 4.3 м как исключительная длина.

В то время как монстры-мамбы длиной около 4,3 м или даже больше могли быть замечены в прошлом, такие большие особи больше не встречаются, так же как большие бивни среди слона ушли в прошлое.

Часто бывает трудно получить точное измерение змей в дикой природе, особенно когда животное свернуто калачиком или быстро переходит дорогу.

Мифы
Одна из теорий относительно того, как Черная Мамба получила свое название, состоит в том, что первоначально ее называли черноротой мамбой, которая со временем стала сокращенно до черной мамбы.Изучив много старой литературы и работ Эжена Марэ, который много (и неточно) писал о мамбах, я предполагаю, что некоторые старые темные люди считались черными, отсюда и общее название.

Черная мамба также считается чрезвычайно агрессивной, и есть много сообщений о том, что мамбы преследовали людей верхом на лошади. Агрессивная часть и рассказ о том, что мамбы преследуют людей, просто неправда. Другой популярный миф — это миф о мамбе, которая свисает с дерева, а затем кусает и убивает пять коров, когда они входят в крааль.Хотя для Черной Мамбы не исключено убить корову или лошадь, такое случается редко. И убить пять коров крайне маловероятно как из-за яда этой змеи, так и из-за того, что убивать крупных коров, не представляющих реальной угрозы для мамбы, просто не в их природе.

Еще есть мифический Ндлондло — массивная Черная Мамба с пером на голове, которая движется невероятно быстро и ударяет, как молния. Он движется так быстро, что перышко издает свистящий звук.Иногда Ндлондло прячется в кустах и ​​плачет, как младенец — если вы пойдете в кусты для расследования, вы рискуете быть убитыми этой змеей. Согласно мифу, это самая опасная змея в мире. Я поговорил с Фортуной Сибайей, хранителем рептилий в Лодже ДумаЗулу возле Хлухлуве в Зулуленде, и у него есть довольно интересный взгляд на эту мифическую змею: у великого царя Шаки раньше было большое перо в головном уборе, как и у его воинов, и Фортуна считает, что они назывались Ндлондло. Они были бесстрашными воинами, как и их короли, и их репутация в конечном итоге перешла к Черной Мамбе. Другая теория состоит в том, что кто-то, возможно, наблюдал за тем, что теряла мамба, и видел над головой кусок кожи, напоминающий перо. В любом случае, Ндлондло никогда не видели.

В Намибии есть также мифическая Берг Мамба — скрытная змея, которую редко можно увидеть, но она становится настолько большой, что, когда она приближается к защищенному от шакалов забору с отверстиями, достаточно большими, чтобы проткнуть ваш кулак, змея должна перелететь через забор. иначе он может застрять.

Aggression & Venom
Относительно агрессии Черной Мамбы и ее смертельного укуса. Доктор Дэррил Вуд и некоторые из его коллег недавно выпустили статью об укусе змей в Зулуленде — они проанализировали 879 укусов змей за пятилетний период, когда жертвы попадали в больницу. Только 5 укусов были явно нейротоксичными и, по всей вероятности, были укусами черной мамбы. В среднем это один укус в год — опять же явно не то, что можно было бы ожидать от агрессивной змеи, которая является плодовитой в Зулуленде.

То, что он обладает очень сильным нейротоксическим ядом, не вызывает сомнений. Максимальный выход яда большой черной мамбы часто составляет 400 мг, но, вероятно, он ближе к 280 мг. Для смертельного укуса человека требуется около 15-20 мг яда. Несмотря на смертоносную репутацию этой змеи, существует удивительное количество жертв, которые выживают после ее укуса, но в тяжелых случаях могут потребоваться большие дозы поливалентного средства. В то время как в среднем для лечения потребуется 10-15 флаконов, одному пациенту в Зулуленде потребовалось 40 флаконов, и он полностью выздоровел.

Хотя большинство смертей от укусов змей в Южной Африке происходит в результате укусов черной мамбы и кейп-кобры, лечение очень эффективно и часто спасает жизнь. Однако крайне важно доставить пострадавших в больницу и подключить к аппарату искусственной вентиляции легких (при необходимости) или использовать маску клапана мешка, если пострадавший не дышит.

Хотя эта змея имеет репутацию самой опасной змеи в Африке, на самом деле это застенчивая и неуловимая змея, которая будет любой ценой стараться избегать людей.

Нейтрализация in vivo дендротоксин-опосредованной нейротоксичности яда черной мамбы олигоклональными человеческими антителами IgG

Фракционирование яда

Объединенные Яд D. polylepis из нескольких образцов, происходящих из Кении, был получен в лиофилизированной форме от France Latoxan SAS, France. Фракции яда Dp5, Dp6, Dp7 и Dp8, содержащие дендротоксины из D. polylepis , были выделены из сырого яда методом RP-HPLC (Agilent 1200) на колонке C 18 (250 × 4.6 мм, частицы 5 мкм; Текнокрома). Элюирование проводили со скоростью 1 мл / мин, используя раствор A (вода, содержащий 0,1% TFA) и градиент по направлению к раствору B (ацетонитрил, содержащий 0,1% TFA): 0% B в течение 5 минут, 0-15% B в течение 10 минут. , 15–45% B за 60 минут, 45–70% B за 10 минут и 70% B за 9 минут. Фракции собирали вручную и сушили в вакуумной центрифуге 11 .

Биотинилирование и MS-анализ токсинов

Фракции яда растворяли в фосфатно-солевом буфере (PBS, фосфатно-солевой буфер Дульбекко; Sigma-Aldrich) до концентраций 0.85–6,39 мкг / мкл. Биотин, связанный с N -гидроксисукцинимидом (NHS) через линкер PEG 4 (EZ-Link ™ NHS-PEG 4 -Biotin, No-Weigh ™ Format, Thermo Scientific, 21329), добавляли к растворам токсинов. при молярных соотношениях от 1: 1 до 1: 2 (токсин: реагент биотинилирования) и оставляли при комнатной температуре на 30 мин. Колонки с обменным буфером (Vivacon 500, Sartorius, 2000 Da Molecular Weight Cut-Off) использовали для очистки биотинилированных токсинов с использованием трех промывок 500 мкл PBS и объема элюирования 150 мкл PBS.Концентрации белка определяли на основе индивидуально рассчитанных коэффициентов экстинкции (http://web.expasy. org/protparam/) и оптических плотностей, измеренных на флуоресцентном спектрофотометре BMG labtech PHERAStar. Степень биотинилирования анализировали с помощью MALDI-TOF в масс-спектрометре Proteomics Analyzer 4800 Plus (Applied Biosystems), чтобы убедиться, что избыточного биотинилирования не произошло 23 .

Выбор фагового дисплея и первичный скрининг

Для выбора фагового дисплея использовалась библиотека фагового дисплея IONTAS.Эта библиотека представляет собой библиотеку фагового дисплея антител человека из 4 × 10 10 клонов с антителами в форме одноцепочечных вариабельных фрагментов (scFvs), которые были сконструированы из B-лимфоцитов, собранных у 43 неиммунизированных доноров-людей 24 . Отбор scFv-связывающих веществ из библиотеки фагового дисплея IONTAS и первичный скрининг TRF-анализа на связывающие дендротоксины были выполнены, как описано в другом месте 24,25 . Вкратце, отобранные антитела субклонировали из вектора фагового дисплея с использованием сайтов рестрикционных эндонуклеаз Nco I и Not I в вектор для экспрессии растворимых scFv 19 и трансформировали в E. coli штамм BL21 (DE3) (New England Biolabs). Отбирали отдельные клоны scFv (до 188 клонов scFv против каждой мишени), экспрессировали в 96-луночном формате, и супернатанты, содержащие scFv, тестировали на связывание с их соответствующими мишенями фракции яда (1–5 мкг / мл), косвенно иммобилизованных на стрептавидине ( 10 мкг / мл) покрытых MaxiSorp планшетов с использованием системы DELFIA 25 . Для обнаружения связывания использовали разведение 1 из 1500 анти-FLAG M2 (Sigma, F1804), конъюгированного с европием (помечено Perkin Elmers).Было отобрано и секвенировано 94 связывающих вещества против каждой мишени (служба секвенирования Eurofin Genomics) с использованием праймера S10b (GGCTTTGTTAGCAGCCGGATCTCA). Каркас антитела и области CDR были аннотированы и проанализированы для идентификации уникальных клонов.

Анализ нормализованного по экспрессии (ENC)

Для анализа ENC черные планшеты MaxiSorp (Nunc) покрывали на ночь антителом против FLAG M2 (Sigma, 2,5 мкг / мл в PBS, 50 мкл на лунку). После блокирования 2% M-PBS (обезжиренное молоко в PBS), промывания PBS и добавления 30 мкл 6% M-PBS в каждую лунку 30 мкл индивидуальных супернатантов аутоиндукционной культуры 20 , содержащих экспрессированный scFv, были добавляли для каждого scFv в аналитический планшет.Планшеты трижды промывали PBS-T (PBS, 0,1% Tween-20) и трижды PBS. Связывание биотинилированного антигена (тестировали с использованием 2,5 нМ и 25 нМ каждого антигена в 2% M-PBS, 50 мкл на лунку в течение 1 ч) определяли с использованием стрептавидина, меченного европием (Perkin Elmer, 1244-360, 1 мкг / мл. в PBS-M, 50 мкл на лунку в течение 30 мин).

Экспрессия и очистка IgG

Гены V H и V L 30 антител, которые показали наивысший сигнал связывания в анализе ENC, были субклонированы в вектор экспрессии млекопитающих с двойным промотором.Вектор pINT3-hg1 (фиг.6) имеет кассету экспрессии двойного промотора, в которой экспрессия тяжелой цепи контролируется промотором цитомегаловируса (CMV), а экспрессия легкой цепи управляется фактором элонгации-1 альфа (EF1-альфа). ) промоутер. Альтернативный вектор (pINT54-hg1) с двойным промотором CMV, управляющим экспрессией как тяжелой, так и легкой цепи, также был доступен и использовался в некоторых случаях. Цепи V H выбранных антител были амплифицированы из вектора scFv pSANG10 с использованием праймеров pSang10_pelB (CGCTGCCCAGCCGGCCATGG) и HLINK3_R (CTGAACCGCCTCCACCACTCGA), а цепи V L (GCTGAT) (GCTGATGAT) были амплифицированы с использованием праймеров (GGCGGATGAT) (GGCGGTGTGTGTGTGTGTGTGTGTGTGT20)Амплифицированные гены V H расщепляли рестрикционными эндонуклеазами Nco I и Xho I, а гены V L расщепляли рестрикционными эндонуклеазами Nhe I и Not I. Расщепленные фрагменты гена V H и V L лигировали в плазмиды pINT3-Hg1 или pINT54 hg1 (расщепленные эндонуклеазами рестрикции Nhe I и Xho I) вместе со вставочным фрагментом (расщепленным Nco I и Not I эндонуклеаз рестрикции), кодирующих константную область легкой цепи (C L ), и промотор CMV в виде четырехчастного лигирования с использованием ДНК-лигазы Т4 (Roche, 10481220001).

Рис. 6

Схематическое изображение генетических элементов, присутствующих в векторе pINT3-hg1

Для экспрессии антител IgG в клетках млекопитающих готовили ДНК, пригодную для трансфекции, с использованием набора Plasmid Plus (Qiagen, 12945). Всего 180 мкг ДНК трансфецировали в 180 мл клеток Expi293 TM (Thermo Fisher) с использованием набора для трансфекции ExpiFectamine TM 293 (Thermo Fisher, A14525) в соответствии с инструкциями производителя. Клетки собирали через 6 дней инкубации при 37 ° C, 5% CO 2 , 130 об / мин на орбитальном шейкере 25 мм.Антитела очищали из культуральных супернатантов хроматографией на протеине А с использованием системы Äkta Pure (GE Healthcare). Первоначальную очистку проводили с использованием колонки HiTrap MabSelect SuRe 5 мл (GE Healthcare, 11-0034-94), используя 0,1 М цитратный буфер (pH 3,0) для элюции. Элюированные белки нейтрализовали половиной объема 1 М Трис (pH 8,0) и дважды диализовали против 4 л 2 × PBS при 4 ° C с использованием диализных трубок GeBAflex Maxi (Generon, D035). Диализированные белки концентрировали с использованием фильтров для ультрацентрифугирования Amicon (Merck Millipore, UFC905024) в соответствии с инструкциями производителя.Функциональность очищенных IgG подтверждается анализом связывания TRF. В этом анализе связывание IgG с биотинилированными фракциями яда, иммобилизованными на покрытых стрептавидином планшетах Nunc MaxiSorp, детектировали с использованием антител против человека, конъюгированных с европием (Perkin Elmers, 1244-330, разведение 1 в 1000).

Идентификация целевого токсина для IgG

Каждый моноклональный IgG был смешан в молярном соотношении 4: 1 (IgG: токсин) с 0,5 мкг фракции яда, против которой он был выбран, или с цельным ядом, и добавлен к 20 мкл суспензии гранул протеиновой G-агарозы (Sigma P7700) в 50 мкл 0.05 M Tris, 0,75 M KCl, буфер pH 7,0, содержащий 2% бычьего сывороточного альбумина. Смеси инкубировали 30 мин при комнатной температуре в термомиксере (Eppendorf) при 700 об / мин. После центрифугирования в течение 15 с при 5000 × g шарики дважды промывали 200 мкл того же буфера, дважды 200 мкл PBS и, наконец, дважды 200 мкл деионизированной воды. После удаления супернатанта от последней промывки шарики ресуспендировали в 20 мкл насыщенного раствора α-циано- 4 -гидроксикоричной кислоты в 50% ацетонитриле и 50% воды, содержащем 0.1% трифторуксусной кислоты и 1 мг / мл одноосновного фосфата аммония. Образцы перемешивали встряхиванием в течение нескольких секунд, центрифугировали в течение 15 секунд, и 1 мкл супернатанта наносили на планшет Opti-TOF 384, сушили и анализировали с помощью MALDI-TOF на 4800-Plus Proteomics Analyzer (Applied Biosystems ). Спектры TOF были получены в линейно-положительном режиме с использованием 500 выстрелов при интенсивности лазера 4200. Идентификация семейства токсинов была достигнута путем сравнения полученных масс с ранее сообщенными значениями 26 .

Животные

Анализы in vivo проводили на мышах CD-1 (18–20 г) обоего пола, предоставленных Instituto Clodomiro Picado, в соответствии с протоколами, утвержденными Институциональным комитетом по использованию и уходу за животными (CICUA), Университет Коста-Рики. Мышей содержали в клетках разного размера для групп по 4–12 человек, им давали пищу и воду ad libitum.

Исследования нейтрализации с помощью интрацеребровентрикулярной инъекции

Нейтрализующая активность отдельных IgG и коктейлей IgG в отношении как дендротоксинов, так и цельного яда тестировалась интрацеребровентрикулярным методом (т.е.cv) инъекции группам от трех до четырех мышей (масса тела 18–20 г, оба пола) с использованием разных доз каждой фракции яда и цельного яда (0,5–1,5 мкг на мышь) и разных молярных соотношений токсин: IgG (1: 0,5, 1: 0,75, 1: 1, 1: 2, 1: 3, 1: 4 и 1: 6). Дозы яда и фракции яда были выбраны так, чтобы обеспечить 100% -ную смертность. Смешивали IgG и фракции яда / весь яд, и растворы инкубировали (30 мин либо при комнатной температуре, либо при 37 ° C). После инкубации мышам вводили объем 5–33 мкл (в зависимости от исходной концентрации IgG).Контрольным мышам с нерелевантной специфичностью вводили фракции яда / цельный яд и антитела к лизоциму IgG, растворенные в фосфатно-солевом буфере (PBS; 0,12 M NaCl, 0,04 M натрий-фосфатный буфер, pH 7,2), а контрольным мышам с носителем вводили яд. фракции / весь яд в PBS. Регистрировали время смерти и использовали кривые Каплана-Мейера для представления выживаемости мышей. Для целей сравнения поливалентное противоядие SAIMR (южноафриканские производители вакцин, партия BC02645) тестировали аналогичным образом.Это противоядие представляет собой препарат F (ab ’) 2 , полученный из плазмы лошадей, иммунизированных смесью ядов десяти видов змей, включая D. polylepis 27 . Различные разведения этого противоядия инкубировали с фиксированной концентрацией яда D. polylepis . Контроли включали только яд и только противоядие. После инкубации аликвоты по 10 мкл, содержащие 1,5 мкг яда, вводили i.c.v., как описано, и регистрировали случаи смерти. Кроме того, противоядие нейтрализации летальности D.яд polylepis был протестирован i.v. маршрут, как описано ранее 11 .

Исследования нейтрализации с помощью внутривенной инъекции

Активность нейтрализации IgG против трехпальцевых токсинов и цельного яда тестировали путем внутривенной (в / в) инъекции в группах из четырех мышей (масса тела 18-20 г), используя контрольную дозу 20,1 мкг для фракции яда Dp6, 10,6 мкг для фракции Dp7 и 25,8 мкг цельного яда, а молярное соотношение токсин: IgG составляет 1: 3. Дозы яда и фракции яда были выбраны так, чтобы обеспечить 100% -ную смертность.IgG и фракции яда / цельный яд смешивали и инкубировали (30 мин при комнатной температуре). Затем аликвоты смесей вводили в хвостовую вену, используя объем инъекции 100–300 мкл. Контрольным мышам с нерелевантной специфичностью инъецировали фракции яда / цельный яд и антилизоцимный IgG, растворенный в PBS, тогда как контрольным мышам с носителем вводили фракции яда / цельный яд в PBS. Регистрировали время смерти и использовали кривые Каплана-Мейера для представления выживаемости мышей.

Выращенное в лаборатории противоядие показывает потенциал для излечения от укуса черной мамбы

Когда-нибудь противоядия можно будет производить в лаборатории, а не на животных.Исследователи из Технического университета Дании впервые нейтрализовали яд черной мамбы у мышей с помощью лабораторных человеческих антител.

Укус змеи — серьезная проблема, от которой ежегодно умирает около 100 000 человек, и примерно в три раза больше людей страдают постоянной инвалидностью. Развивающиеся страны больше затронуты этой проблемой, чем развитые страны.

Подобрать подходящее противоядие для каждого змеиного яда сопряжено с трудностями. «Текущие противоядия, которые являются единственным существующим лечением, являются дефицитными и дорогими», — сказал мне Андреас Лаустсен, самопровозглашенный «Snakebite Jesus» из Технического университета Дании и ведущий автор исследования. «Это приводит к тому, что большинство жертв змеиных укусов во многих тропических регионах мира остаются без лечения».

Обычные противоядия производятся путем введения млекопитающим, например лошадям, небольшой дозы яда, а затем сбора у них антител против яда. Недостатком этого является то, что антитела различаются по эффективности, и пациенты могут иметь побочные реакции из-за животного происхождения лечения. Таким образом, существует очевидная потребность в более безопасных противоядиях.

Исследовательская группа создала новое лабораторное противоядие человеческого происхождения против яда черной мамбы, вида змей, вырабатывающих опасные нейротоксины. Для этого они выращивали человеческие антитела на поверхности вирусов, заражающих бактерии, называемых бактериофагами. Затем они использовали токсины черной мамбы, чтобы «выловить» лучшие связывающие антитела в море бактериофагов.

Вирусы бактериофагов инфицируют бактерии

Как только у них будут лучшие антитела к токсинам черной мамбы, объяснил Лаустен, команда смогла извлечь их генетические чертежи и произвести больше, прежде чем тестировать их на целых животных.

В недавнем исследовании, проведенном в сотрудничестве с британской компанией Iontas и Instituto Clodomiro Picado в Коста-Рике, исследователи использовали эти лабораторно выращенные человеческие антитела на мышах после введения им яда черной мамбы. Лечение улучшило их выживаемость до 100%, тогда как нелеченные мыши погибли.

Хотя в настоящее время все еще далеко от клиники, эти выращенные в лаборатории антитела могут быть более безопасным источником противоядий, чем существующие методы лечения, как выразил энтузиазм Лаустен: « Это новый подход к разработке принципиально нового типа противоядий от змеиного укуса.

Лаустен является соучредителем биотехнологической компании VenomAb, которая занимается разработкой методов производства антител против яда.

Примечательно также, что изобретатель метода, который исследователи использовали для выявления антител против яда, фагового дисплея, стал на этой неделе совместным лауреатом Нобелевской премии.


Изображения из Shutterstock

Раскрытие природы яда черной мамбы (Dendroaspis polylepis) с помощью ядовитых веществ и иммунного профилирования противоядия: Идентификация основных токсиновых мишеней для разработки противоядия

Без маркировки: Впервые охарактеризован протеом яда черной мамбы Dendroaspis polylepis из Восточной Африки.Сорок различных белков и один нуклеозид были идентифицированы или отнесены к семействам белков. Наиболее распространенными белками были ингибиторы протеиназ типа Кунитца, которые включают уникальные компоненты яда мамбы «дендротоксины», а также α-нейротоксины и другие представители семейства токсинов с тремя пальцами. Кроме того, яд содержит более низкий процент белков из других семейств, включая металлопротеиназу, гиалуронидазу, прокинетицин, фактор роста нервов, фактор роста эндотелия сосудов, фосфолипазу A2, 5′-нуклеотидазу и фосфодиэстеразу.Оценка острой токсичности показала, что наиболее летальными компонентами были α-нейротоксины и, в меньшей степени, дендротоксины. Этот яд также содержит относительно высокую концентрацию аденозина, который может способствовать токсичности, влияя на биораспределение токсина. Иммунопрофилирование с помощью ELISA и доклиническая оценка нейтрализации показали, что полиспецифические противоядия, производимые в Южной Африке и Индии, были эффективны в нейтрализации яда D. polylepis, хотя и проявляли различную активность.Противоядия имели более высокие титры антител против α-нейротоксинов, чем против дендротоксинов, и имели высокие титры против менее токсичных белков с высокой молекулярной массой. Наши результаты раскрывают сложность яда D. polylepis и предоставляют информацию для идентификации его наиболее важных токсинов, которые необходимо нейтрализовать с помощью противоядий. Биологическое значение: Черная мамба, D. polylepis, — одна из самых страшных змей в мире из-за силы ее яда, тяжести и быстрого проявления клинических проявлений отравлений, а также ее способности быстро и многократно наносить удары.Настоящее исследование сообщает о первом протеомном анализе этого яда. Результаты выявили сложный яд, состоящий преимущественно из белков, принадлежащих к семейству ингибиторов протеиназ типа Кунитца, которое включает дендротоксины, и к α-нейротоксинам семейства токсинов с тремя пальцами. Белки, проявляющие наивысшую острую токсичность, представляли собой α-нейротоксины, которые вызывают постсинаптическую блокаду нервно-мышечных соединений, за которыми следуют дендротоксины, которые ингибируют потенциал-зависимые калиевые каналы.Комбинация этих двух типов токсинов в яде подчеркивает наличие двойной стратегии, которая приводит к высокоэффективному механизму субдукции добычи. Этот сложный токсический арсенал, вероятно, обеспечит D. polylepis высокую трофическую универсальность. Быстрое начало и тяжесть нейротоксических клинических проявлений при отравлении D. polylepis требуют быстрого введения эффективных и безопасных противоядий. Доклинические испытания показали, что противоядие из Южной Африки и два противоядия из Индии были эффективны в нейтрализации этого яда, хотя и различались по своей эффективности.Более того, иммунопрофилирование с помощью ELISA этих противоядий против всех фракций яда выявило, что противоядия имеют более высокие титры против α-нейротоксинов, чем против дендротоксинов, что подчеркивает необходимость разработки улучшенных стратегий иммунизации. Результаты этого исследования определили наиболее важные токсины, присутствующие в яде D. polylepis, на которые необходимо воздействовать противоядиями или ингибиторами другого типа.

Факты о черной мамбе: мифы и реальность: отделить мифы

Черная мамба ( Dendroaspis polylepis ) — очень ядовитая африканская змея.Легенды, связанные с черной мамбой, снискали ей титул «самой смертоносной змеи в мире».

Укус черной мамбы называется «поцелуем смерти», и говорят, что он балансирует на конце своего хвоста, возвышаясь над жертвами перед нанесением удара. Также считается, что змея скользит быстрее, чем человек или лошадь.

Однако, несмотря на эту устрашающую репутацию, многие легенды ложны. Черная мамба потенциально опасна, но очень застенчива. Вот правда о черной мамбе.

Быстрые факты: змея черная мамба

  • Научное название : Dendroaspis polylepis
  • Общее название : Черная мамба
  • Основная группа животных : Рептилии
  • Размер : 6,5-14,7 футов
  • Вес : 3,5 фунта 17 903 Продолжительность жизни : 11 лет
  • Диета : Плотоядное животное
  • Среда обитания : Африка к югу от Сахары
  • Население : стабильно
  • Статус сохранения : наименьшее беспокойство

Описание

Цвет этой змеи варьируется от оливкового до серого до темно-коричневого с желтым низом. Молодые змеи по окраске бледнее взрослых. Змея получила свое общее название за чернильно-черный цвет ее рта, который она открывает и показывает, когда ей угрожают. Как и ее родственник, коралловая змея, черная мамба покрыта гладкой плоской чешуей.

Черная мамба — самая длинная ядовитая змея в Африке и вторая по длине ядовитая змея в мире после королевской кобры. Длина черных мамб составляет от 2 до 4,5 метров (от 6,6 до 14,8 футов), а средний вес — 1 штука.6 кг (3,5 фунта). Когда змея поднимается, чтобы нанести удар, она может показаться , чтобы балансировать на своем хвосте, но это просто иллюзия, созданная тем фактом, что ее тело необычно длинное, а также тем фактом, что ее окраска сливается с окружающей средой.

Скорость

Хотя черная мамба — самая быстрая змея в Африке и, возможно, самая быстрая змея в мире, она использует свою скорость, чтобы избежать опасности, а не охотиться на добычу. Змея была зафиксирована на скорости 11 км / ч (6.8 миль / ч) на расстояние 43 м (141 фут). Для сравнения, средний человек женского пола бежит 6,5 миль в час, в то время как средний мужчина человека бежит со скоростью 8,3 миль в час. И мужчины, и женщины могут намного быстрее бегать на короткие дистанции. Лошадь скачет на скорости от 25 до 30 миль в час. Черные мамбы не преследуют людей, лошадей или машины, но даже если бы они и преследовали их, змея не смогла бы поддерживать свой пиковый темп достаточно долго, чтобы догнать.

Среда обитания и распространение

Черная мамба встречается в Африке к югу от Сахары. Его ареал простирается от северной части Южной Африки до Сенегала.Змея процветает в умеренно засушливых местах обитания, включая леса, саванны и каменистую местность.

Диета и поведение

Когда еды много, черная мамба поддерживает постоянное логово, решаясь днем ​​искать добычу. Змея питается даманами, птицами, летучими мышами и кустарниками. Это хищник-засадник, который охотится на глаз. Когда жертва оказывается в пределах досягаемости, змея поднимается от земли, ударяет один или несколько раз и ждет, пока ее яд парализует и убьет жертву, прежде чем съесть ее.

Размножение и потомство

Недавно вылупившиеся черные змеи мамба должны сами заботиться о себе. Кэтлин Зекер / EyeEm / Getty Images

Спариваются черные мамбы ранней весной. Самцы следуют по запаху самки и могут соревноваться за нее, борясь друг с другом, но не кусаясь. Летом самка откладывает кладку от 6 до 17 яиц, а затем покидает гнездо. Птенцы выходят из яиц через 80–90 дней. Пока их ядовитые железы полностью развиты, молодые змеи полагаются на питательные вещества из яичного желтка, пока не найдут маленькую добычу.

Черные мамбы, как правило, мало взаимодействуют друг с другом, но, как известно, они делят логово с другими мамбами или даже с другими видами змей. Продолжительность жизни черной мамбы в дикой природе неизвестна, но известно, что особи в неволе живут 11 лет.

Сохранение статуса

Черная мамба не находится под угрозой исчезновения, с классификацией «наименее опасной» в Красном списке исчезающих видов МСОП . Змеи многочисленны по всему ареалу и имеют стабильную популяцию.

Однако черная мамба действительно сталкивается с некоторыми угрозами. Люди убивают змей из-за страха, к тому же у животного есть хищники. Кейп-напильник ( Mehelya capensis ) невосприимчив ко всему яду африканских змей и охотится на любую черную мамбу, достаточно маленькую, чтобы ее проглотить. Мангусты частично невосприимчивы к яду черной мамбы и достаточно быстры, чтобы убить молодую змею, не будучи укушенной. Змеиные орлы охотятся на черную мамбу, особенно на черногрудого змеиного орла ( Circaetus pectoralis ) и коричневого змеиного орла ( Circaetus cinereus ).

Черная мамба и люди

Укусы редки, потому что змея избегает людей, не агрессивна и не защищает свое логово. Первая помощь включает в себя надавливание или наложение жгута, чтобы замедлить распространение яда, с последующим введением противоядия. В сельской местности противоядие может быть недоступно, поэтому смертельные случаи все равно происходят.

Яд змеи — это мощный коктейль, содержащий нейротоксин, дендротоксин, кардиотоксины и фасцикулины, сокращающие мышцы.Ранние симптомы укуса включают головную боль, металлический привкус, обильное слюноотделение и потоотделение, а также ощущение покалывания. При укусе человек теряет сознание менее чем за 45 минут и может умереть в течение 7-15 часов. Конечная причина смерти — дыхательная недостаточность, удушье и сердечно-сосудистая недостаточность. До появления противоядия смертность от укусов черной мамбы составляла почти 100%. Хотя и редко, есть случаи выживания без лечения.

Источники

  • ФитцСимонс, Вивиан Ф.М. Полевой путеводитель по змеям Южной Африки (Второе изд.). HarperCollins. С. 167–169, 1970. ISBN 0-00-212146-8.
  • Мэттисон, Крис. Змеи мира . Нью-Йорк: Факты о File, Inc. стр. 164, 1987. ISBN 0-8160-1082-X.
  • Spawls, S. « Dendroaspis polylepis «. Красный список видов, находящихся под угрозой исчезновения МСОП . МСОП. 2010: e.T177584A7461853. DOI: 10.2305 / IUCN.UK.2010-4.RLTS.T177584A7461853.en
  • Spawls, S.; Бранч, Б. Опасные змеи Африки: естественная история, каталог видов, яды и змеиный укус . Дубай: Восточная пресса: Ральф Кертис-Букс. С. 49–51, 1995. ISBN 0-88359-029-8.
  • Страйдом, Дэниел. «Токсины змеиного яда». Журнал биологической химии . 247 (12): 4029–42, 1971. PMID 5033401

Яд черной мамбы — Typographica

В альтернативной вселенной, где шрифты — это рептилии, а компьютеры дизайнеров — секретные лаборатории для генетической модификации, Черная мамба — это тщательно спланированная случайность скрещивания.Его укус графическому дизайнеру может привести к опасным состояниям, таким как пробудившееся типографское сознание, красиво диссонирующие композиции или усиление экспериментального отношения.

Гарнитура с заглавными буквами Black Mamba Venom от лаборатории швейцарских шрифтов действительно является замечательным сочетанием. Два члена суперсемейства SangBleu с противоположных концов спектра вызвались принять участие в слиянии. С одной стороны, это SangBleu Sunrise Air, без засечек; на другом — SangBleu Empire Bold, высококонтрастный шрифт с засечками в традиции Дидо.Эти два образуют основу шрифта; Кстати, это также свидетельствует о тщательном проектировании семейства SangBleu, которое позволяет даже этим очевидным несоответствиям плавно совмещаться.

Но это только начало приключений! Людмила Бредихина нарисовала набор новых персонажей, основываясь на концепции глючного слияния двух шрифтов, в результате чего получаются энергичные змеевидные формы и захватывающе какофоническое изображение текста.

В средневековой библейской традиции большое разнообразие орнаментированных инициалов и завитков пера создавало разнообразное текстовое изображение, создавая динамику на странице и путевые знаки в содержании.Инициалы и орнаменты были переведены в канон подвижного шрифта, а шрифты регулярно дополнялись закрашенными буквами, что давало наборщикам возможность «оживить» свои макеты с помощью чисто типографских инструментов.

Хотя закрашенные символы часто встречаются в возрожденных и современных шрифтах, они редко используются в реальном типографском дизайне. Может быть, из-за их (чрезмерно) традиционной внешности? Или потому, что они спрятаны в конце набора глифов? В любом случае, Black Mamba кажется лекарством от этой проблемы.Хотя это никогда не планировалось как возрождение, в концептуальном смысле оно одно. Он возвращает к идее использования чистой типографики как средства выделения, ориентира и инструмента повествования в макете. Смелые современные формы Black Mamba — это готовый набор специальных символов для современного дизайнера, который не боится его нестандартных форм.

Позиционировать Black Mamba за пределами семейства SangBleu — ничего, если не умно. Специальные символы могли быть скрыты в семье как стилистические альтернативы или, возможно, как дополнительный вес.Но давайте будем честными: с такой индивидуальностью наша змея никогда не смогла бы остаться пленником этих рамок.

Добавить комментарий

Ваш адрес email не будет опубликован.